Cre-Lox recombination

Last updated

Cre-Lox recombination is a site-specific recombinase technology, used to carry out deletions, insertions, translocations and inversions at specific sites in the DNA of cells. It allows the DNA modification to be targeted to a specific cell type or be triggered by a specific external stimulus. It is implemented both in eukaryotic and prokaryotic systems. The Cre-lox recombination system has been particularly useful to help neuroscientists to study the brain in which complex cell types and neural circuits come together to generate cognition and behaviors. NIH Blueprint for Neuroscience Research has created several hundreds of Cre driver mouse lines which are currently used by the worldwide neuroscience community.

Contents

An important application of the Cre-lox system is excision of selectable markers in gene replacement. Commonly used gene replacement strategies introduce selectable markers into the genome to facilitate selection of genetic mutations that may cause growth retardation. However, marker expression can have polar effects on the expression of upstream and downstream genes. Removal of selectable markers from the genome by Cre-lox recombination is an elegant and efficient way to circumvent this problem and is therefore widely used in plants, mouse cell lines, yeast, etc. [1]

The system consists of a single enzyme, Cre recombinase, that recombines a pair of short target sequences called the Lox sequences. This system can be implemented without inserting any extra supporting proteins or sequences. The Cre enzyme and the original Lox site called the LoxP sequence are derived from bacteriophage P1.

Placing Lox sequences appropriately allows genes to be activated, repressed, or exchanged for other genes. At a DNA level many types of manipulations can be carried out. The activity of the Cre enzyme can be controlled so that it is expressed in a particular cell type or triggered by an external stimulus like a chemical signal or a heat shock. These targeted DNA changes are useful in cell lineage tracing and when mutants are lethal if expressed globally.

The Cre-Lox system is very similar in action and in usage to the FLP-FRT recombination system. [2]

History

Cre-Lox recombination is a special type of site-specific recombination developed by Dr. Brian Sauer and patented by DuPont that operated in both mitotic and non-mitotic cells, and was initially used in activating gene expression in mammalian cell lines. [3] [4] [5] Subsequently, researchers in the laboratory of Dr. Jamey Marth demonstrated that Cre-Lox recombination could be used to delete loxP-flanked chromosomal DNA sequences at high efficiency in specific developing T-cells of transgenic animals, with the authors proposing that this approach could be used to define endogenous gene function in specific cell types, indelibly mark progenitors in cell fate determination studies, induce specific chromosomal rearrangements for biological and disease modeling, and determine the roles of early genetic lesions in disease (and phenotype) maintenance. [6]

Shortly thereafter, researchers in the laboratory of Prof. Klaus Rajewsky reported the production of pluripotent embryonic stem cells bearing a targeted loxP-flanked (floxed) DNA polymerase gene. [7] Combining these advances in collaboration, the laboratories of Drs. Marth and Rajewsky reported in 1994 that Cre-lox recombination could be used for conditional gene targeting. [8] They observed ≈50% of the DNA polymerase beta gene was deleted in T cells based on DNA blotting. It was unclear whether only one allele in each T-cell or 50% of T cells had 100% deletion in both alleles. Researchers have since reported more efficient Cre-Lox conditional gene mutagenesis in the developing T cells by the Marth laboratory in 1995. [9] Incomplete deletion by Cre recombinase is not uncommon in cells when two copies of floxed sequences exist, and allows the formation and study of chimeric tissues. All cell types tested in mice have been shown to undergo transgenic Cre recombination.

Independently, Joe Z. Tsien has pioneered the use of Cre-loxP system for cell type- and region-specific gene manipulation in the adult brain where hundreds of distinct neuron types may exist and nearly all neurons in the adult brain are known to be post-mitotic. [10] Tsien and his colleagues demonstrated Cre-mediated recombination can occur in the post-mitotic pyramidal neurons in the adult mouse forebrain. [11]

These developments have led to a widespread use of conditional mutagenesis in biomedical research, spanning many disciplines in which it becomes a powerful platform for determining gene function in specific cell types and at specific developmental times. In particular, the clear demonstration of its usefulness in precisely defining the complex relationship between specific cells/circuits and behaviors for brain research, [12] has promoted the NIH to initiate the NIH Blueprint for Neuroscience Research Cre-driver mouse projects in early 2000. [13] [14] To date, NIH Blueprint for Neuroscience Research Cre projects have created several hundreds of Cre driver mouse lines which are currently used by the worldwide neuroscience community.

Overview

Cre-Lox recombination involves the targeting of a specific sequence of DNA and splicing it with the help of an enzyme called Cre recombinase. Cre-Lox recombination is commonly used to circumvent embryonic lethality caused by systemic inactivation of many genes. [15] [16] As of February 2019, Cre–Lox recombination is a powerful tool and is used in transgenic animal modeling to link genotypes to phenotypes. [12] [17] [18]

The Cre-lox system is used as a genetic tool to control site specific recombination events in genomic DNA. This system has allowed researchers to manipulate a variety of genetically modified organisms to control gene expression, delete undesired DNA sequences and modify chromosome architecture.

The Cre protein is a site-specific DNA recombinase that can catalyse the recombination of DNA between specific sites in a DNA molecule. These sites, known as loxP sequences, contain specific binding sites for Cre that surround a directional core sequence where recombination can occur.

A diagram describing how Lox71 and Lox66 sites can be used to combine two plasmids into one contiguous plasmid. Cre Lox71-66 Recombination Method.png
A diagram describing how Lox71 and Lox66 sites can be used to combine two plasmids into one contiguous plasmid.

When cells that have loxP sites in their genome express Cre, a recombination event can occur between the loxP sites. Cre recombinase proteins bind to the first and last 13 bp regions of a lox site forming a dimer. This dimer then binds to a dimer on another lox site to form a tetramer. Lox sites are directional and the two sites joined by the tetramer are parallel in orientation. The double stranded DNA is cut at both loxP sites by the Cre protein. The strands are then rejoined with DNA ligase in a quick and efficient process. The result of recombination depends on the orientation of the loxP sites. For two lox sites on the same chromosome arm, inverted loxP sites will cause an inversion of the intervening DNA, while a direct repeat of loxP sites will cause a deletion event. If loxP sites are on different chromosomes it is possible for translocation events to be catalysed by Cre induced recombination. Two plasmids can be joined using the variant lox sites 71 and 66. [19]

Cre recombinase

Cre recombinase can be synthesized by the corresponding gene under the direction of cell-specific promoters, including promoters under the control of doxycycline. An additional level of control can be achieved by using his Cre recombinase, engineered to reversibly activate in the presence of the estrogen analogue 4-hydroxy tamoxifen. This provides the advantage that the Cre recombinase is active for a short time. This prevents non-specific actions of Cre recombinase. The Cre recombinase can recognize cryptic sites in the host genome and induce unauthorized recombination, damaging host DNA. This tool is suitable for deleting antibiotic resistance genes, but above all it allows conditional knockouts that can be induced at specific times in the cell type of choice. Models thus obtained are more likely to mimic the physiological situation. [20]

The Cre protein (encoded by the locus originally named as "Causes recombination", with "Cyclization recombinase" being found in some references) [21] [22] consists of 4 subunits and two domains: The larger carboxyl (C-terminal) domain, and smaller amino (N-terminal) domain. The total protein has 343 amino acids. The C domain is similar in structure to the domain in the Integrase family of enzymes isolated from lambda phage. This is also the catalytic site of the enzyme.

loxP site

loxP (locus of X-over P1) is a site on the bacteriophage P1 consisting of 34 bp. The site includes an asymmetric 8 bp sequence, variable except for the middle two bases, in between two sets of symmetric, 13 bp sequences. The exact sequence is given below; 'N' indicates bases which may vary, and lowercase letters indicate bases that have been mutated from the wild-type. The 13 bp sequences are palindromic but the 8 bp spacer is not, thus giving the loxP sequence a certain direction. Usually loxP sites come in pairs for genetic manipulation. If the two loxP sites are in the same orientation, the floxed sequence (sequence flanked by two loxP sites) is excised; however if the two loxP sites are in the opposite orientation, the floxed sequence is inverted. If there exists a floxed donor sequence, the donor sequence can be swapped with the original sequence. This technique is called recombinase-mediated cassette exchange and is a very convenient and time-saving way for genetic manipulation. The caveat, however, is that the recombination reaction can happen backwards, rendering cassette exchange inefficient. In addition, sequence excision can happen in trans instead of a in cis cassette exchange event. The loxP mutants are created to avoid these problems. [23]

13bp8bp13bp
ATAACTTCGTATA -NNNTANNN-TATACGAAGTTAT
Example Alternate loxP Sites [24] [25]
Name13bp Recognition Region8bp Spacer Region13bp Recognition Region
Wild-TypeATAACTTCGTATAATGTATGCTATACGAAGTTAT
lox 511ATAACTTCGTATAATGTATaCTATACGAAGTTAT
lox 5171ATAACTTCGTATAATGTgTaCTATACGAAGTTAT
lox 2272ATAACTTCGTATAAaGTATcCTATACGAAGTTAT
M2ATAACTTCGTATAAgaaAccaTATACGAAGTTAT
M3ATAACTTCGTATAtaaTACCATATACGAAGTTAT
M7ATAACTTCGTATAAgaTAGAATATACGAAGTTAT
M11ATAACTTCGTATAcgaTAccaTATACGAAGTTAT
lox 71TACCGTTCGTATANNNTANNNTATACGAAGTTAT
lox 66ATAACTTCGTATANNNTANNNTATACGAACGGTA
loxPsymATAACTTCGTATAatgtacatTATACGAAGTTAT

Holliday junctions and homologous recombination

During genetic recombination, a Holliday junction is formed between the two strands of DNA and a double-stranded break in a DNA molecule leaves a 3’OH end exposed. This reaction is aided with the endonuclease activity of an enzyme. 5’ Phosphate ends are usually the substrates for this reaction, thus extended 3’ regions remain. This 3’ OH group is highly unstable, and the strand on which it is present must find its complement. Since homologous recombination occurs after DNA replication, two strands of DNA are available, and thus, the 3’ OH group must pair with its complement, and it does so, with an intact strand on the other duplex. Now, one point of crossover has occurred, which is what is called a Holliday Intermediate.

The 3’OH end is elongated (that is, bases are added) with the help of DNA Polymerase. The pairing of opposite strands is what constitutes the crossing-over or Recombination event, which is common to all living organisms, since the genetic material on one strand of one duplex has paired with one strand of another duplex, and has been elongated by DNA polymerase. Further cleavage of Holliday Intermediates results in formation of Hybrid DNA.

This further cleavage or ‘resolvation’ is done by a special group of enzymes called Resolvases. RuvC is just one of these Resolvases that have been isolated in bacteria and yeast.

For many years, it was thought that when the Holliday junction intermediate was formed, the branch point of the junction (where the strands cross over) would be located at the first cleavage site. Migration of the branch point to the second cleavage site would then somehow trigger the second half of the pathway. This model provided convenient explanation for the strict requirement for homology between recombining sites, since branch migration would stall at a mismatch and would not allow the second strand exchange to occur. In more recent years, however, this view has been challenged, and most of the current models for Int, Xer, and Flp recombination involve only limited branch migration (1–3 base pairs of the Holliday intermediate), coupled to an isomerisation event that is responsible for switching the strand cleavage specificity.

Site-specific recombination

Site-specific recombination (SSR) involves specific sites for the catalyzing action of special enzymes called recombinases. Cre, or cyclic recombinase, is one such enzyme. Site-specific recombination is, thus, the enzyme-mediated cleavage and ligation of two defined deoxynucleotide sequences.

A number of conserved site-specific recombination systems have been described in both prokaryotic and eukaryotic organisms. In general, these systems use one or more proteins and act on unique asymmetric DNA sequences. The products of the recombination event depend on the relative orientation of these asymmetric sequences. Many other proteins apart from the recombinase are involved in regulating the reaction. During site-specific DNA recombination, which brings about genetic rearrangement in processes such as viral integration and excision and chromosomal segregation, these recombinase enzymes recognize specific DNA sequences and catalyse the reciprocal exchange of DNA strands between these sites.

Mechanism of action

A model experiment in genetics using the Cre-lox system: the premature stop sequence present in floxed mice is removed only from cells that express Cre recombinase when the mice are bred together CreLoxP experiment.png
A model experiment in genetics using the Cre-lox system: the premature stop sequence present in floxed mice is removed only from cells that express Cre recombinase when the mice are bred together

Initiation of site-specific recombination begins with the binding of recombination proteins to their respective DNA targets. A separate recombinase recognizes and binds to each of two recombination sites on two different DNA molecules or within the same DNA strand. At the given specific site on the DNA, the hydroxyl group of the tyrosine in the recombinase attacks a phosphate group in the DNA backbone using a direct transesterification mechanism. This reaction links the recombinase protein to the DNA via a phospho-tyrosine linkage. This conserves the energy of the phosphodiester bond, allowing the reaction to be reversed without the involvement of a high-energy cofactor.

Cleavage on the other strand also causes a phospho-tyrosine bond between DNA and the enzyme. At both of the DNA duplexes, the bonding of the phosphate group to tyrosine residues leave a 3’ OH group free in the DNA backbone. In fact, the enzyme-DNA complex is an intermediate stage, which is followed by the ligation of the 3’ OH group of one DNA strand to the 5’ phosphate group of the other DNA strand, which is covalently bonded to the tyrosine residue; that is, the covalent linkage between 5’ end and tyrosine residue is broken. This reaction synthesizes the Holliday junction discussed earlier.

In this fashion, opposite DNA strands are joined together. Subsequent cleavage and rejoining cause DNA strands to exchange their segments. Protein-protein interactions drive and direct strand exchange. Energy is not compromised, since the protein-DNA linkage makes up for the loss of the phosphodiester bond, which occurred during cleavage.

Site-specific recombination is also an important process that viruses, such as bacteriophages, adopt to integrate their genetic material into the infected host. The virus, called a prophage in such a state, accomplishes this via integration and excision. The points where the integration and excision reactions occur are called the attachment (att) sites. An attP site on the phage exchanges segments with an attB site on the bacterial DNA. Thus, these are site-specific, occurring only at the respective att sites. The integrase class of enzymes catalyse this particular reaction.

Efficiency of action

Two factors have been shown to affect the efficiency of Cre's excision on the lox pair. First, the nucleotide sequence identity in the spacer region of lox site. Engineered lox variants which differ on the spacer region tend to have varied but generally lower recombination efficiency compared to wildtype loxP, presumably through affecting the formation and resolution of recombination intermediate. [26]

Another factor is the length of DNA between the lox pair. Increasing the length of DNA leads to decreased efficiency of Cre/lox recombination possibly through regulating the dynamics of the reaction. [27] [28] [29] Genetic location of the floxed sequence affects recombination efficiency as well probably by influencing the availability of DNA by Cre recombinase. [29] The choice of Cre driver is also important as low expression of Cre recombinase tends to result in non-parallel recombination. Non-parallel recombination is especially problematic in a fate mapping scenario where one recombination event is designed to manipulate the gene under study and the other recombination event is necessary for activating a reporter gene (usually encoding a fluorescent protein) for cell lineage tracing. [29] Failure to activate both recombination events simultaneously confounds the interpretation of cell fate mapping results.

Temporal control

Inducible Cre activation is achieved using CreER (estrogen receptor) variant, which is only activated after delivery of tamoxifen. [30] This is done through the fusion of a mutated ligand binding domain of the estrogen receptor to the Cre recombinase, resulting in Cre becoming specifically activated by tamoxifen. In the absence of tamoxifen, CreER will result in the shuttling of the mutated recombinase into the cytoplasm. The protein will stay in this location in its inactivated state until tamoxifen is given. Once tamoxifen is introduced, it is metabolized into 4-hydroxytamoxifen, which then binds to the ER and results in the translocation of the CreER into the nucleus, where it is then able to cleave the lox sites. [31] Importantly, sometimes fluorescent reporters can be activated in the absence of tamoxifen, due to leakage of a few Cre recombinase molecules into the nucleus which, in combination with very sensitive reporters, results in unintended cell labelling. [32] CreER(T2) was developed to minimize tamoxifen-independent recombination and maximize tamoxifen-sensitivity.

Conditional cell lineage tracing

Cells alter their phenotype in response to numerous environmental stimuli and can lose the expression of genes typically used to mark their identity, making it difficult to research the contribution of certain cell types to disease. Therefore, researchers often use transgenic mice expressing CreERt2 recombinase induced by tamoxifen administration, under the control of a promoter of a gene that marks the specific cell type of interest, with a Cre-dependent fluorescent protein reporter. The Cre recombinase is fused to a mutant form of the oestrogen receptor, which binds the synthetic oestrogen 4-hydroxytamoxifen instead of its natural ligand 17β-estradiol. CreER(T2) resides within the cytoplasm and can only translocate to the nucleus following tamoxifen administration, allowing tight temporal control of recombination. The fluorescent reporter cassette will contain a promoter to permit high expression of the fluorescent transgene reporter (e.g. a CAG promoter) and a loxP flanked stop cassette, ensuring the expression of the transgene is Cre-recombinase dependent and the reporter sequence. Upon Cre driven recombination, the stop cassette is excised, allowing reporter genes to express specifically in cells in which the Cre expression is being driven by the cell-specific marker promoter. Since removal of the stop cassette is permanent, the reporter genes are expressed in all the progeny produced by the initial cells where the Cre was once activated. Such conditional lineage tracing has proved to be extremely useful to efficiently and specifically identify vascular smooth muscle cells (VSMCs) and VSMC-derived cells and has been used to test effects on VSMC and VSMC-derived cells in vivo. [33] [34] [35] [36] [37] [38]

Natural function of the Cre-lox system

The P1 phage is a temperate phage that causes either a lysogenic or lytic cycle when it infects a bacterium. In its lytic state, once its viral genome is injected into the host cell, viral proteins are produced, virions are assembled, and the host cell is lysed to release the phages, continuing the cycle. In the lysogenic cycle the phage genome replicates with the rest of the bacterial genome and is transmitted to daughter cells at each subsequent cell division. It can transition to the lytic cycle by a later event such as UV radiation or starvation.

Phages like the lambda phage use their site specific recombinases to integrate their DNA into the host genome during lysogeny. P1 phage DNA on the other hand, exists as a plasmid in the host. The Cre-lox system serves several functions in the phage: it circularizes the phage DNA into a plasmid, separates interlinked plasmid rings so they are passed to both daughter bacteria equally and may help maintain copy numbers through an alternative means of replication. [39]

The P1 phage DNA when released into the host from the virion is in the form of a linear double stranded DNA molecule. The Cre enzyme targets loxP sites at the ends of this molecule and cyclises the genome. This can also take place in the absence of the Cre lox system [40] with the help of other bacterial and viral proteins. The P1 plasmid is relatively large (≈90Kbp) and hence exists in a low copy number - usually one per cell. If the two daughter plasmids get interlinked one of the daughter cells of the host will lose the plasmid. The Cre-lox recombination system prevents these situations by unlinking the rings of DNA by carrying out two recombination events (linked rings -> single fused ring -> two unlinked rings). It is also proposed that rolling circle replication followed by recombination will allow the plasmid to increase its copy number when certain regulators (repA) are limiting. [39]

Implementation of multiple loxP site pairs

A classical strategy for generating gene deletion variants is based on double cross-integration of non-replicating vectors into the genome. Furthermore, recombination systems such as Cre-lox are widely used, mostly in eukaryotes. The versatile properties of Cre recombinase make it ideal for use in many genetic engineering strategies. As such, the Cre lox system has been used in a wide variety of eukaryotes, including plants. [41]

Multiple variants of loxP, [42] in particular lox2272 and loxN, have been used by researchers with the combination of different Cre actions (transient or constitutive) to create a "Brainbow" system that allows multi-colouring of mice's brain with four fluorescent proteins.

Another report using two lox variants pair but through regulating the length of DNA in one pair results in stochastic gene activation with regulated level of sparseness. [27]

Notes and references

  1. ↑ 10.1006/meth.2001.1159
  2. ↑ Turan S, Galla M, Ernst E, Qiao J, Voelkel C, Schiedlmeier B, et al. (March 2011). "Recombinase-mediated cassette exchange (RMCE): traditional concepts and current challenges". Journal of Molecular Biology. 407 (2): 193–221. doi:10.1016/j.jmb.2011.01.004. PMID   21241707.
  3. ↑ "Site-specific recombination of DNA in eukaryotic cells".
  4. ↑ Sauer B (June 1987). "Functional expression of the cre-lox site-specific recombination system in the yeast Saccharomyces cerevisiae". Molecular and Cellular Biology. 7 (6): 2087–96. doi:10.1128/mcb.7.6.2087. PMC   365329 . PMID   3037344.
  5. ↑ Sauer B, Henderson N (July 1988). "Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1". Proceedings of the National Academy of Sciences of the United States of America. 85 (14): 5166–70. Bibcode:1988PNAS...85.5166S. doi: 10.1073/pnas.85.14.5166 . PMC   281709 . PMID   2839833.
  6. ↑ Orban PC, Chui D, Marth JD (August 1992). "Tissue- and site-specific DNA recombination in transgenic mice". Proceedings of the National Academy of Sciences of the United States of America. 89 (15): 6861–5. Bibcode:1992PNAS...89.6861O. doi: 10.1073/pnas.89.15.6861 . PMC   49604 . PMID   1495975.
  7. ↑ Gu H, Zou YR, Rajewsky K (June 1993). "Independent control of immunoglobulin switch recombination at individual switch regions evidenced through Cre-loxP-mediated gene targeting". Cell. 73 (6): 1155–64. doi:10.1016/0092-8674(93)90644-6. PMID   8513499. S2CID   29537406.
  8. ↑ Gu H, Marth JD, Orban PC, Mossmann H, Rajewsky K (July 1994). "Deletion of a DNA polymerase beta gene segment in T cells using cell type-specific gene targeting". Science. 265 (5168): 103–6. Bibcode:1994Sci...265..103G. doi:10.1126/science.8016642. PMID   8016642.
  9. ↑ Hennet T, Hagen FK, Tabak LA, Marth JD (December 1995). "T-cell-specific deletion of a polypeptide N-acetylgalactosaminyl-transferase gene by site-directed recombination". Proceedings of the National Academy of Sciences of the United States of America. 92 (26): 12070–4. Bibcode:1995PNAS...9212070H. doi: 10.1073/pnas.92.26.12070 . PMC   40298 . PMID   8618846.
  10. ↑ Tsien JZ (2016). "Cre-Lox Neurogenetics: 20 Years of Versatile Applications in Brain Research and Counting…". Frontiers in Genetics. 7: 19. doi: 10.3389/fgene.2016.00019 . PMC   4759636 . PMID   26925095.
  11. ↑ Tsien JZ, Chen DF, Gerber D, Tom C, Mercer EH, Anderson DJ, et al. (December 1996). "Subregion- and cell type-restricted gene knockout in mouse brain". Cell. 87 (7): 1317–26. doi: 10.1016/s0092-8674(00)81826-7 . PMID   8980237.
  12. 1 2 Tsien JZ, Huerta PT, Tonegawa S (December 1996). "The essential role of hippocampal CA1 NMDA receptor-dependent synaptic plasticity in spatial memory". Cell. 87 (7): 1327–38. doi: 10.1016/s0092-8674(00)81827-9 . PMID   8980238.
  13. ↑ NIH blueprint for neuroscience: Cre driver network. http://www.neuroscienceblueprint.nih.gov/factSheet/CreDriver.htm
  14. ↑ GENSAT brain project, http://www.gensat.org/index.html
  15. ↑ Shen J, Bronson RT, Chen DF, Xia W, Selkoe DJ, Tonegawa S (May 1997). "Skeletal and CNS defects in Presenilin-1-deficient mice". Cell. 89 (4): 629–39. doi: 10.1016/s0092-8674(00)80244-5 . PMID   9160754.
  16. ↑ Li Y, Erzurumlu RS, Chen C, Jhaveri S, Tonegawa S (February 1994). "Whisker-related neuronal patterns fail to develop in the trigeminal brainstem nuclei of NMDAR1 knockout mice". Cell. 76 (3): 427–37. doi:10.1016/0092-8674(94)90108-2. PMID   8313466. S2CID   35342965.
  17. ↑ Feng R, Rampon C, Tang YP, Shrom D, Jin J, Kyin M, et al. (December 2001). "Deficient neurogenesis in forebrain-specific presenilin-1 knockout mice is associated with reduced clearance of hippocampal memory traces". Neuron. 32 (5): 911–26. doi: 10.1016/s0896-6273(01)00523-2 . PMID   11738035.
  18. ↑ "Cre-Lox Recombination".
  19. ↑ Hastie AR, Pruitt SC (2007). "Yeast two-hybrid interaction partner screening through in vivo Cre-mediated Binary Interaction Tag generation". Nucleic Acids Research. 35 (21): e141. doi:10.1093/nar/gkm894. PMC   2189736 . PMID   17986461.
  20. ↑ https://doi.org/10.1006/meth.2001.1159
  21. ↑ "Cyclization recombinase [Escherichia coli] - Protein - NCBI".
  22. ↑ Sternberg N, Hamilton D (August 1981). "Bacteriophage P1 site-specific recombination. I. Recombination between loxP sites". Journal of Molecular Biology. 150 (4): 467–86. doi:10.1016/0022-2836(81)90375-2. PMID   6276557.
  23. ↑ Araki K, Araki M, Yamamura K (February 1997). "Targeted integration of DNA using mutant lox sites in embryonic stem cells". Nucleic Acids Research. 25 (4): 868–72. doi:10.1093/nar/25.4.868. PMC   146486 . PMID   9016639.
  24. ↑ Missirlis PI, Smailus DE, Holt RA (April 2006). "A high-throughput screen identifying sequence and promiscuity characteristics of the loxP spacer region in Cre-mediated recombination". BMC Genomics. 7: 73. doi:10.1186/1471-2164-7-73. PMC   1479339 . PMID   16595017.
  25. ↑ Hoess, Ronald H.; Wierzbicki, Anna; Abremski, Kenneth (1986). "The role of theloxPspacer region in PI site-specific recombination". Nucleic Acids Research. 14 (5): 2287–2300. doi:10.1093/nar/14.5.2287. ISSN   0305-1048.
  26. ↑ Lee G, Saito I (August 1998). "Role of nucleotide sequences of loxP spacer region in Cre-mediated recombination". Gene. 216 (1): 55–65. doi:10.1016/s0378-1119(98)00325-4. PMID   9714735.
  27. 1 2 Wang SZ, Liu BH, Tao HW, Xia K, Zhang LI (2009). "A genetic strategy for stochastic gene activation with regulated sparseness (STARS)". PLOS ONE. 4 (1): e4200. Bibcode:2009PLoSO...4.4200W. doi: 10.1371/journal.pone.0004200 . PMC   2615212 . PMID   19145242.
  28. ↑ Zheng B, Sage M, Sheppeard EA, Jurecic V, Bradley A (January 2000). "Engineering mouse chromosomes with Cre-loxP: range, efficiency, and somatic applications". Molecular and Cellular Biology. 20 (2): 648–55. doi:10.1128/mcb.20.2.648-655.2000. PMC   85158 . PMID   10611243.
  29. 1 2 3 Liu J, Willet SG, Bankaitis ED, Xu Y, Wright CV, Gu G (June 2013). "Non-parallel recombination limits Cre-LoxP-based reporters as precise indicators of conditional genetic manipulation". Genesis. 51 (6): 436–42. doi:10.1002/dvg.22384. PMC   3696028 . PMID   23441020.
  30. ↑ Walrath JC, Hawes JJ, Van Dyke T, Reilly KM (2010). "Genetically engineered mouse models in cancer research". Advances in Cancer Research. 106: 113–64. doi:10.1016/S0065-230X(10)06004-5. ISBN   9780123747716. PMC   3533445 . PMID   20399958.
  31. ↑ Kristianto J, Johnson MG, Zastrow RK, Radcliff AB, Blank RD (June 2017). "Spontaneous recombinase activity of Cre-ERT2 in vivo". Transgenic Research. 26 (3): 411–417. doi:10.1007/s11248-017-0018-1. PMC   9474299 . PMID   28409408. S2CID   4377498.
  32. ↑ Álvarez-Aznar A, Martínez-Corral I, Daubel N, Betsholtz C, Mäkinen T, Gaengel K (February 2020). "T2 lines". Transgenic Research. 29 (1): 53–68. doi:10.1007/s11248-019-00177-8. PMC   7000517 . PMID   31641921.
  33. ↑ Harman JL, Dobnikar L, Chappell J, Stokell BG, Dalby A, Foote K, et al. (November 2019). "Epigenetic Regulation of Vascular Smooth Muscle Cells by Histone H3 Lysine 9 Dimethylation Attenuates Target Gene-Induction by Inflammatory Signaling". Arteriosclerosis, Thrombosis, and Vascular Biology. 39 (11): 2289–2302. doi:10.1161/ATVBAHA.119.312765. PMC   6818986 . PMID   31434493.
  34. ↑ Chappell J, Harman JL, Narasimhan VM, Yu H, Foote K, Simons BD, et al. (December 2016). "Extensive Proliferation of a Subset of Differentiated, yet Plastic, Medial Vascular Smooth Muscle Cells Contributes to Neointimal Formation in Mouse Injury and Atherosclerosis Models". Circulation Research. 119 (12): 1313–1323. doi:10.1161/CIRCRESAHA.116.309799. PMC   5149073 . PMID   27682618.
  35. ↑ Herring BP, Hoggatt AM, Burlak C, Offermanns S (2014). "Previously differentiated medial vascular smooth muscle cells contribute to neointima formation following vascular injury". Vascular Cell. 6 (1): 21. doi:10.1186/2045-824X-6-21. PMC   4193961 . PMID   25309723.
  36. ↑ Shankman LS, Gomez D, Cherepanova OA, Salmon M, Alencar GF, Haskins RM, et al. (June 2015). "KLF4-dependent phenotypic modulation of smooth muscle cells has a key role in atherosclerotic plaque pathogenesis". Nature Medicine. 21 (6): 628–37. doi:10.1038/nm.3866. PMC   4552085 . PMID   25985364.
  37. ↑ Albarrán-Juárez J, Kaur H, Grimm M, Offermanns S, Wettschureck N (August 2016). "Lineage tracing of cells involved in atherosclerosis". Atherosclerosis. 251: 445–453. doi: 10.1016/j.atherosclerosis.2016.06.012 . PMID   27320174.
  38. ↑ Dobnikar L, Taylor AL, Chappell J, Oldach P, Harman JL, Oerton E, et al. (November 2018). "Disease-relevant transcriptional signatures identified in individual smooth muscle cells from healthy mouse vessels". Nature Communications. 9 (1): 4567. Bibcode:2018NatCo...9.4567D. doi:10.1038/s41467-018-06891-x. PMC   6212435 . PMID   30385745.
  39. 1 2 Łobocka MB, Rose DJ, Plunkett G, Rusin M, Samojedny A, Lehnherr H, et al. (November 2004). "Genome of bacteriophage P1". Journal of Bacteriology. 186 (21): 7032–68. doi:10.1128/JB.186.21.7032-7068.2004. PMC   523184 . PMID   15489417.
  40. ↑ Sternberg N, Hoess R (1983). "The molecular genetics of bacteriophage P1". Annual Review of Genetics. 17 (1): 123–54. doi:10.1146/annurev.ge.17.120183.001011. PMID   6364958.
  41. ↑ https://doi.org/10.1128%2FAEM.01473-06
  42. ↑ Livet J, Weissman TA, Kang H, Draft RW, Lu J, Bennis RA, et al. (November 2007). "Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous system". Editorial Summary ("Over the brainbow"). Nature. 450 (7166): 56–62. Bibcode:2007Natur.450...56L. doi:10.1038/nature06293. PMID   17972876. S2CID   4402093.


Related Research Articles

Gene knockouts are a widely used genetic engineering technique that involves the targeted removal or inactivation of a specific gene within an organism's genome. This can be done through a variety of methods, including homologous recombination, CRISPR-Cas9, and TALENs.

The restriction modification system is found in bacteria and other prokaryotic organisms, and provides a defense against foreign DNA, such as that borne by bacteriophages.

<span class="mw-page-title-main">Library (biology)</span>

In molecular biology, a library is a collection of DNA fragments that is stored and propagated in a population of micro-organisms through the process of molecular cloning. There are different types of DNA libraries, including cDNA libraries, genomic libraries and randomized mutant libraries. DNA library technology is a mainstay of current molecular biology, genetic engineering, and protein engineering, and the applications of these libraries depend on the source of the original DNA fragments. There are differences in the cloning vectors and techniques used in library preparation, but in general each DNA fragment is uniquely inserted into a cloning vector and the pool of recombinant DNA molecules is then transferred into a population of bacteria or yeast such that each organism contains on average one construct. As the population of organisms is grown in culture, the DNA molecules contained within them are copied and propagated.

A transgene is a gene that has been transferred naturally, or by any of a number of genetic engineering techniques, from one organism to another. The introduction of a transgene, in a process known as transgenesis, has the potential to change the phenotype of an organism. Transgene describes a segment of DNA containing a gene sequence that has been isolated from one organism and is introduced into a different organism. This non-native segment of DNA may either retain the ability to produce RNA or protein in the transgenic organism or alter the normal function of the transgenic organism's genetic code. In general, the DNA is incorporated into the organism's germ line. For example, in higher vertebrates this can be accomplished by injecting the foreign DNA into the nucleus of a fertilized ovum. This technique is routinely used to introduce human disease genes or other genes of interest into strains of laboratory mice to study the function or pathology involved with that particular gene.

Site-specific recombinase technologies are genome engineering tools that depend on recombinase enzymes to replace targeted sections of DNA.

<span class="mw-page-title-main">Cre recombinase</span> Genetic recombination enzyme

Cre recombinase is a tyrosine recombinase enzyme derived from the P1 bacteriophage. The enzyme uses a topoisomerase I-like mechanism to carry out site specific recombination events. The enzyme (38kDa) is a member of the integrase family of site specific recombinase and it is known to catalyse the site specific recombination event between two DNA recognition sites. This 34 base pair (bp) loxP recognition site consists of two 13 bp palindromic sequences which flank an 8bp spacer region. The products of Cre-mediated recombination at loxP sites are dependent upon the location and relative orientation of the loxP sites. Two separate DNA species both containing loxP sites can undergo fusion as the result of Cre mediated recombination. DNA sequences found between two loxP sites are said to be "floxed". In this case the products of Cre mediated recombination depends upon the orientation of the loxP sites. DNA found between two loxP sites oriented in the same direction will be excised as a circular loop of DNA whilst intervening DNA between two loxP sites that are opposingly orientated will be inverted. The enzyme requires no additional cofactors or accessory proteins for its function.

Recombinases are genetic recombination enzymes.

<span class="mw-page-title-main">FLP-FRT recombination</span>

In genetics, Flp-FRT recombination is a site-directed recombination technology, increasingly used to manipulate an organism's DNA under controlled conditions in vivo. It is analogous to Cre-lox recombination but involves the recombination of sequences between short flippase recognition target (FRT) sites by the recombinase flippase (Flp) derived from the 2 µ plasmid of baker's yeast Saccharomyces cerevisiae.

<span class="mw-page-title-main">I-CreI</span>

I-CreI is a homing endonuclease whose gene was first discovered in the chloroplast genome of Chlamydomonas reinhardtii, a species of unicellular green algae. It is named for the facts that: it resides in an Intron; it was isolated from Clamydomonas reinhardtii; it was the first (I) such gene isolated from C. reinhardtii. Its gene resides in a group I intron in the 23S ribosomal RNA gene of the C. reinhardtii chloroplast, and I-CreI is only expressed when its mRNA is spliced from the primary transcript of the 23S gene. I-CreI enzyme, which functions as a homodimer, recognizes a 22-nucleotide sequence of duplex DNA and cleaves one phosphodiester bond on each strand at specific positions. I-CreI is a member of the LAGLIDADG family of homing endonucleases, all of which have a conserved LAGLIDADG amino acid motif that contributes to their associative domains and active sites. When the I-CreI-containing intron encounters a 23S allele lacking the intron, I-CreI enzyme "homes" in on the "intron-minus" allele of 23S and effects its parent intron's insertion into the intron-minus allele. Introns with this behavior are called mobile introns. Because I-CreI provides for its own propagation while conferring no benefit on its host, it is an example of selfish DNA.

P1 is a temperate bacteriophage that infects Escherichia coli and some other bacteria. When undergoing a lysogenic cycle the phage genome exists as a plasmid in the bacterium unlike other phages that integrate into the host DNA. P1 has an icosahedral head containing the DNA attached to a contractile tail with six tail fibers. The P1 phage has gained research interest because it can be used to transfer DNA from one bacterial cell to another in a process known as transduction. As it replicates during its lytic cycle it captures fragments of the host chromosome. If the resulting viral particles are used to infect a different host the captured DNA fragments can be integrated into the new host's genome. This method of in vivo genetic engineering was widely used for many years and is still used today, though to a lesser extent. P1 can also be used to create the P1-derived artificial chromosome cloning vector which can carry relatively large fragments of DNA. P1 encodes a site-specific recombinase, Cre, that is widely used to carry out cell-specific or time-specific DNA recombination by flanking the target DNA with loxP sites.

Site-specific recombination, also known as conservative site-specific recombination, is a type of genetic recombination in which DNA strand exchange takes place between segments possessing at least a certain degree of sequence homology. Enzymes known as site-specific recombinases (SSRs) perform rearrangements of DNA segments by recognizing and binding to short, specific DNA sequences (sites), at which they cleave the DNA backbone, exchange the two DNA helices involved, and rejoin the DNA strands. In some cases the presence of a recombinase enzyme and the recombination sites is sufficient for the reaction to proceed; in other systems a number of accessory proteins and/or accessory sites are required. Many different genome modification strategies, among these recombinase-mediated cassette exchange (RMCE), an advanced approach for the targeted introduction of transcription units into predetermined genomic loci, rely on SSRs.

The Tn3 transposon is a 4957 base pair mobile genetic element, found in prokaryotes. It encodes three proteins:

Conditional gene knockout is a technique used to eliminate a specific gene in a certain tissue, such as the liver. This technique is useful to study the role of individual genes in living organisms. It differs from traditional gene knockout because it targets specific genes at specific times rather than being deleted from beginning of life. Using the conditional gene knockout technique eliminates many of the side effects from traditional gene knockout. In traditional gene knockout, embryonic death from a gene mutation can occur, and this prevents scientists from studying the gene in adults. Some tissues cannot be studied properly in isolation, so the gene must be inactive in a certain tissue while remaining active in others. With this technology, scientists are able to knockout genes at a specific stage in development and study how the knockout of a gene in one tissue affects the same gene in other tissues.

RMCE is a procedure in reverse genetics allowing the systematic, repeated modification of higher eukaryotic genomes by targeted integration, based on the features of site-specific recombination processes (SSRs). For RMCE, this is achieved by the clean exchange of a preexisting gene cassette for an analogous cassette carrying the "gene of interest" (GOI).

<span class="mw-page-title-main">Brainbow</span> Neuroimaging technique to differentiate neurons

Brainbow is a process by which individual neurons in the brain can be distinguished from neighboring neurons using fluorescent proteins. By randomly expressing different ratios of red, green, and blue derivatives of green fluorescent protein in individual neurons, it is possible to flag each neuron with a distinctive color. This process has been a major contribution to the field of neural connectomics.

A P1-derived artificial chromosome, or PAC, is a DNA construct derived from the DNA of P1 bacteriophages and Bacterial artificial chromosome. It can carry large amounts of other sequences for a variety of bioengineering purposes in bacteria. It is one type of the efficient cloning vector used to clone DNA fragments in Escherichia coli cells.

<span class="mw-page-title-main">Floxing</span> Sandwiching of a DNA sequence between two lox P sites

In genetics, floxing refers to the sandwiching of a DNA sequence between two lox P sites. The terms are constructed upon the phrase "flanking/flanked by LoxP". Recombination between LoxP sites is catalysed by Cre recombinase. Floxing a gene allows it to be deleted, translocated or inverted in a process called Cre-Lox recombination. The floxing of genes is essential in the development of scientific model systems as it allows researchers to have spatial and temporal alteration of gene expression. Moreover, animals such as mice can be used as models to study human disease. Therefore, Cre-lox system can be used in mice to manipulate gene expression in order to study human diseases and drug development. For example, using the Cre-lox system, researchers can study oncogenes and tumor suppressor genes and their role in development and progression of cancer in mice models.

<span class="mw-page-title-main">Genetic engineering techniques</span> Methods used to change the DNA of organisms

Genetic engineering techniques allow the modification of animal and plant genomes. Techniques have been devised to insert, delete, and modify DNA at multiple levels, ranging from a specific base pair in a specific gene to entire genes. There are a number of steps that are followed before a genetically modified organism (GMO) is created. Genetic engineers must first choose what gene they wish to insert, modify, or delete. The gene must then be isolated and incorporated, along with other genetic elements, into a suitable vector. This vector is then used to insert the gene into the host genome, creating a transgenic or edited organism.

<span class="mw-page-title-main">Reverse genetics</span> Method in molecular genetics

Reverse genetics is a method in molecular genetics that is used to help understand the function(s) of a gene by analysing the phenotypic effects caused by genetically engineering specific nucleic acid sequences within the gene. The process proceeds in the opposite direction to forward genetic screens of classical genetics. While forward genetics seeks to find the genetic basis of a phenotype or trait, reverse genetics seeks to find what phenotypes are controlled by particular genetic sequences.

No-SCAR genome editing is an editing method that is able to manipulate the Escherichia coli genome. The system relies on recombineering whereby DNA sequences are combined and manipulated through homologous recombination. No-SCAR is able to manipulate the E. coli genome without the use of the chromosomal markers detailed in previous recombineering methods. Instead, the λ-Red recombination system facilitates donor DNA integration while Cas9 cleaves double-stranded DNA to counter-select against wild-type cells. Although λ-Red and Cas9 genome editing are widely used technologies, the no-SCAR method is novel in combining the two functions; this technique is able to establish point mutations, gene deletions, and short sequence insertions in several genomic loci with increased efficiency and time sensitivity.

This page is based on this Wikipedia article
Text is available under the CC BY-SA 4.0 license; additional terms may apply.
Images, videos and audio are available under their respective licenses.