Haplogroup G-M285

Last updated
Haplogroup G1
Frequency distribution map of Y-chromosomal haplogroup G1-M285.PNG
Possible time of origin18,500 (95% CI 16,800 <-> 20,200) ybp [1]
Possible place of originperhaps Iran
Ancestor Haplogroup G (Y-DNA)
DescendantsG1a, G1b, G1c
Defining mutationsM285 (G1), P20 (G1a), L201, L202, L203 (G1a1), L830, L831, L832, L834, L835 (G1b)

In human genetics, Haplogroup G-M285 or G-M342, also known as Haplogroup G1, is a Y-chromosome haplogroup. Haplogroup G1 is a primary subclade of haplogroup G.

Contents

G1 is possibly believed to have originated in Iran. It has an extremely low frequency in modern populations, except (i) Iran and its western neighbors, and (ii) a region straddling south Central Siberia (Russia) and northern Kazakhstan. The most basal examples of G1 identified in living individuals, which belong to the G-L830 subclade, have been found across an area from the Arabian Peninsula (Northern Borders Region of Saudi Arabia, Ad-Dawhah of Qatar) to Ashkenazi Jews of Belarus (Minsk Region) and China (Anhui). [1] [2]

Genetic features

Almost all G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 SNP mutation which characterizes this group. This value of 12 is also uncommon in other haplogroups. The M designation for M285 indicates it was first identified at Stanford University.

M285 has the following characteristics: The reference ID number is rs13447378.....Y position is 21151128....The forward primer sequence is ttatcctgagccgttgtccctg and the reverse sequence tgtagagacacggttgtaccct....The mutation is G to C. [3] M285 was first reported in 2004 by Cinnioglu et al. [4]

So far all persons tested who have the M285 mutation also are positive the M342 SNP mutation. If someone should test differently, his results would become the basis of a new G1 category. M342 is located at sequence position 21653330 and is AGAGAGTTTTCTAACAGGGCG in the forward primer and TGGGAATCACTTTTGCAACT in the reverse. It is a mutation from C to T. [4] M342 was also identified at Stanford University,

In addition, within haplogroup G, those G1 persons tested so far are uniquely positive (derived) for SNP L89 while all other G persons are negative (ancestral). The L89 SNP mutation has also been found in other haplogroups. L89 is located at sequence position 8038725, and the reference ID number is rs35160044. It is a mutation from T to C. The L89 designation was provided by Family Tree DNA.

Dating of G1 origin

While research studies have not yet dated the origin of G1's M285 SNP mutation, it seemingly represents one of the older G groups, arising perhaps halfway between the origin of G and the present day based on the number of STR marker mutations.

Geographical distribution

Geographical distribution

While most research studies have failed to test for G1, likely or proven examples have been found in four groups (by geography and/or and/or secondary subclade):

The highest reported concentration of G1 and its subgroups in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. Specifically G1 was found in 5% of 177 samples from southern Iran in one study. The same study found G1 in 3% of 33 samples in northern Iran. The percentage in the south was almost equal to the percentage of G2, the only region in the world where G2 types were not found to be heavily dominant. [7] Earlier studies which found about the same percentages of G in various parts of Iran failed to test specifically for G1. [8] [9]

In Turkey, Cinnioglu found 1% of 523 samples of all types belonging to haplogroup G1 and like all available G1 outside Iran G1 was overshadowed by a much larger number of G2 men in the sample. All but one of the G1 samples in this study belonged to the further subgroup G1a, and all the samples were from northeastern Turkey. [10]

A study of Lebanon by Zalloua et al. failed to test for G1, but 26% of 38 G samples had the value of 12 for STR marker DYS392, almost always characteristic of G1. These G1 samples represent only 2% of the 587 total Lebanese samples and were well distributed among all religious groups there. [11]

A broader study of the Levant by El-Sibai et al. also failed to test for G1, but 12% of 17 Syrian G samples had the 12 value at DYS392. These G1 samples represent less than 1% of 354 Syrian samples. In the same study, 21% of 14 Jordanian G samples had the 12 value. These G1 samples represent 1% of 274 Jordanian samples. None of 8 Egyptian G samples had the 12 value. [12]

The likely G samples in the YHRD database [13] from the southern Caucasus area (Azerbaijan, Georgia, Armenia, Abazinia, Abkhazia) and from the northern Caucasus (North Ossetians, Kabardinians, Ingushians, Darginians, Lezginians, Rutulians and Chechnians) have only several 12-value DYS392 samples that might be G1.

Sites with G1 concentrations

The highest concentration of G1 within a distinct group within a country was reported among the Kazakh tribe Argyn – 67% and its branch Madjars of Kazakhstan where G1 persons comprised 87% of 45 samples,. [14]

G1 subgroups

SNP-defined subgroups

Subgroup G1a (P20) is rather common among G1 persons, but the reliability of SNP P20 in identifying G1a persons makes some tests for P20 a problem. [15] P20 results may be reported as P20.1, P20.2 and P20.3, and persons may have varying results for each. The technical features of P20 are: Y position is 25029911; 23396163.....forward primer is tggatctgattcacaggtag.....reverse primer is ccaacaatatgtcacaatctc...the mutation is a deletion of C. [3] The mutation was identified at the University of Arizona and first reported by the Y Chromosome Consortium in 2002. [16] Category G1a has a separate subgroup based on the presence of the value of 8 at short tandem repeat marker DYS494. With the exception of this G1a subgroup, all other G persons have 9 at this slowly mutating marker. So far about half of G1a persons who are otherwise ungrouped have this 8 value. [17]

G1a1 (L201, L202 and L203) were identified in a G1a person tested at Family Tree DNA in fall 2009, Subsequent testing showed that only some G1a persons have these mutations, and so far they are all from a closely related Ashkenazi Jewish cluster of men. The following Y positions were noted: 2718285 for L201, 13001714 for L202 and 13001715 for L203. In L201 the mutation is C to T; in L202 from T to C; and in L203 from A to G. If any man should have one of these SNP mutations without the others, this information would become the basis of a new G1a1 classification.

Old G1b (P76) was removed from the official listing in August, 2012, because its discovery in a single person makes it so far only a private SNP.

G1b (L830, L831, L832, L834, L835) were identified in late 2011 at Family Tree DNA. The G1c mutations are: L830 (T to C at position 6923908), L831 (T to C at position 6991562), L832 (T to G at position 12796626), L834 (T to A at position 16019950), L835 (G to A at position 16291409).

STR marker value clusters

There exist two distinctive European-ancestry Ashkenazi Jewish clusterings within G1a1 and G1c and a distinctive G1a Kazakh cluster—all three based on short tandem repeat (STR) marker values. [18] Men in the Jewish G1c cluster have a value of 12 at STR marker DYS446 which is several values lower than almost all G persons, but the other two groups lack one specific marker value as an identifier. When approximately 30 or more STR markers are available when comparing samples, members in each of the three groups are easily ascertained. One of the distinctive European-ancestry G1c Ashkenazi Jewish STR marker value combinations is found also in an Iraqi Jew in one research study. [19] See also page covering Jews with Haplogroup G (Y-DNA).

Among available 67-marker G1 STR samples, [18] the Ashkenazi G1a1 Jewish cluster represents the closest relatives to the Kazakh G1a cluster based on similarity of STR marker values.

The Ashkenazi G1c cluster is only distantly related to the Ashkenazi G1a1 cluster, and the G1c Ashkenazi cluster has nearest relatives instead among diverse Europeans.

Migrations of G1 persons

The concentration of G1 found today in Iran and adjoining territory to its west suggests, but does not prove, this same area was the site of G1 origin. Due to the lengthy age of G1, distant migrations of small numbers of G1 persons could have occurred at any time during the historical period through a variety of types of population movements. It would be speculative to assume how the Ashkenazi G1 clusters or the Kazakh G1 clusters of men arrived in northeastern Europe and Kazakhstan respectively.

See also

Related Research Articles

Y-chromosomal Aaron is the name given to the hypothesized most recent common ancestor of the patrilineal Jewish priestly caste known as Kohanim. According to the traditional understanding of the Hebrew Bible, this ancestor was Aaron, the brother of Moses.

A genealogical DNA test is a DNA-based genetic test used in genetic genealogy that looks at specific locations of a person's genome in order to find or verify ancestral genealogical relationships, or to estimate the ethnic mixture of an individual. Since different testing companies use different ethnic reference groups and different matching algorithms, ethnicity estimates for an individual vary between tests, sometimes dramatically.

<span class="mw-page-title-main">Haplogroup G-M201</span> Human Y chromosome DNA grouping common in western Eurasia

Haplogroup G (M201) is a human Y-chromosome haplogroup. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK.

<span class="mw-page-title-main">Haplogroup J (Y-DNA)</span> Human Y-chromosome DNA haplogroup

Haplogroup J-M304, also known as J, is a human Y-chromosome DNA haplogroup. It is believed to have evolved in Western Asia. The clade spread from there during the Neolithic, primarily into North Africa, the Horn of Africa, the Socotra Archipelago, the Caucasus, Europe, Anatolia, Central Asia, South Asia, and Southeast Asia.

In human genetics, the Atlantic modal haplotype (AMH) or haplotype 15 is a Y chromosome haplotype of Y-STR microsatellite variations, associated with the Haplogroup R1b. It was discovered prior to many of the SNPs now used to identify subclades of R1b and references to it can be found in some of the older literature. It corresponds most closely with subclade R1b1a2a1a(1) [L11].

<span class="mw-page-title-main">Haplogroup R1</span> Y-chromosome DNA haplogroup

Haplogroup R1, or R-M173, is a Y-chromosome DNA haplogroup. A primary subclade of Haplogroup R (R-M207), it is defined by the SNP M173. The other primary subclade of Haplogroup R is Haplogroup R2 (R-M479).

<span class="mw-page-title-main">Human Y-chromosome DNA haplogroup</span> Human DNA groupings

In human genetics, a human Y-chromosome DNA haplogroup is a haplogroup defined by mutations in the non-recombining portions of DNA from the male-specific Y chromosome. Many people within a haplogroup share similar numbers of short tandem repeats (STRs) and types of mutations called single-nucleotide polymorphisms (SNPs).

Haplogroup R, or R-M207, is a Y-chromosome DNA haplogroup. It is both numerous and widespread amongst modern populations.

Haplogroup R2a, or haplogroup R-M124, is a Y-chromosome haplogroup characterized by genetic markers M124, P249, P267, L266, and is mainly found in South Asia as well as in Central Asia, Caucasus, Southwest Asia, and the Arab countries with low frequencies.

<span class="mw-page-title-main">Haplogroup J-M267</span> Human Y-chromosome DNA haplogroup

Haplogroup J-M267, also commonly known as Haplogroup J1, is a subclade (branch) of Y-DNA haplogroup J-P209 along with its sibling clade haplogroup J-M172.

Haplogroup I-M438, also known as I2, is a human DNA Y-chromosome haplogroup, a subclade of haplogroup I-M170. Haplogroup I-M438 originated some time around 26,000–31,000 BCE. It originated in Europe and developed into several main subgroups: I2-M438*, I2a-L460, I2b-L415 and I2c-L596. The haplogroup can be found all over Europe and reaches its maximum frequency in the Dinaric Alps (Balkans) via founder effect, related to the migrations of the Early Slavs to the Balkan peninsula.

Haplogroup G-M377 is a Y-chromosome haplogroup and is defined by the presence of the M377 mutation. It is a branch of Haplogroup G2b-M3115, which in turn is defined by the presence of the M3115 mutation. It was found among Pashtuns, who are classified as Iranic and on much lower scale among all major Jewish groups, Palestinians, Lebanese and Syrians(See also page covering Jews with Haplogroup G )

<span class="mw-page-title-main">Haplogroup R1b</span> Type of paternal lineage

Haplogroup R1b (R-M343), previously known as Hg1 and Eu18, is a human Y-chromosome haplogroup.

Haplogroup E-V68, also known as E1b1b1a, is a major human Y-chromosome DNA haplogroup found in North Africa, the Horn of Africa, Western Asia and Europe. It is a subclade of the larger and older haplogroup, known as E1b1b or E-M215. The E1b1b1a lineage is identified by the presence of a single nucleotide polymorphism (SNP) mutation on the Y chromosome, which is known as V68. It is a subject of discussion and study in genetics as well as genetic genealogy, archaeology, and historical linguistics.

Haplogroup G-FGC7535, also known as Haplogroup G2a1, is a Y-chromosome haplogroup. It is an immediate descendant of G2a (G-P15), which is a primary branch of haplogroup G2 (P287).

In human genetics, Haplogroup G-P303 is a Y-chromosome haplogroup. It is a branch of haplogroup G (Y-DNA) (M201). In descending order, G-P303 is additionally a branch of G2 (P287), G2a (P15), G2a2, G2a2b, G2a2b2, and finally G2a2b2a. This haplogroup represents the majority of haplogroup G men in most areas of Europe west of Russia and the Black Sea. To the east, G-P303 is found among G persons across the Middle East, Iran, the southern Caucasus area, China, and India. G-P303 exhibits its highest diversity in the Levant.

In human genetics, Haplogroup G-M406 is a Y-chromosome haplogroup. G-M406 is a branch of Haplogroup G Y-DNA (M201). More specifically in descending order, G-M406 is a subbranch also of G2 (P287), G2a (P15) and finally G2a2b (L30/S126) Haplogroup G-M406 seems most common in Turkey and Greece. Secondary concentrations of G-M406 are found in the northern and eastern Mediterranean, and it is found in very small numbers in more inland areas of Europe, the Middle East, and the southern Caucasus Mountains area.

In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup

Genetic studies of Jews are part of the population genetics discipline and are used to analyze the ancestry of Jewish populations, complementing research in other fields such as history, linguistics, archaeology, and paleontology. These studies investigate the origins of various Jewish ethnic divisions. In particular, they examine whether there is a common genetic heritage among them. The medical genetics of Jews are studied for population-specific diseases.

Listed here are notable ethnic groups and populations from Western Asia, Egypt and South Caucasus by human Y-chromosome DNA haplogroups based on relevant studies. The samples are taken from individuals identified with the ethnic and linguistic designations in the first two columns, the third column gives the sample size studied, and the other columns give the percentage of the particular haplogroup. Some old studies conducted in the early 2000s regarded several haplogroups as one haplogroup, e.g. I, G and sometimes J were haplogroup 2, so conversion sometimes may lead to unsubstantial frequencies below.

References

  1. 1 2 YFull YTree v8.07.00 accessed on August 30, 2020
  2. ↑ "Welcome to FamilyTreeDNA Discover (Beta)". FamilyTreeDNA Discover (Beta).
  3. 1 2 Karafat, T.; et al. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–38. doi:10.1101/gr.7172008. PMC   2336805 . PMID   18385274.
  4. 1 2 Cinnioglu, C.; et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia" (PDF). Human Genetics. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID   14586639. S2CID   10763736. Archived from the original (PDF) on 2006-06-19.
  5. ↑ "Haplogroup G Project samples".
  6. ↑ "Haplogroup G Categories, Samples, Diagrams, Etc.: over 2800 G samples from 83 countries". Archived from the original on 2011-09-27.
  7. ↑ Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ (2006). "Iran: tricontinental nexus for Y-chromosome driven migration". Human Heredity. 61 (3): 132–43. doi:10.1159/000093774. PMID   16770078. S2CID   7017701.
  8. ↑ Nasidze, I; et al. (2006). "Concomitant Replacement of Language and mtDNA in South Caspian Populations of Iran". Current Biology. 16 (7): 668–73. doi: 10.1016/j.cub.2006.02.021 . PMID   16581511. S2CID   7883334.
  9. ↑ Nasidze, I; et al. (2008). "Close Genetic Relationship Between Semitic-speaking and Indo-European-speaking Groups in Iran". Annals of Human Genetics. 72 (Pt 2): 241–52. doi:10.1111/j.1469-1809.2007.00413.x. PMID   18205892. S2CID   5873833.
  10. ↑ Cinnioglu, C.; et al. (2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics. 114 (2): 127–48. doi:10.1007/s00439-003-1031-4. PMID   14586639. S2CID   10763736.
  11. ↑ Zalloua, P.; et al. (2008). "Identifying Genetic Traces of Historical Expansions: Phoenician Footprints in the Mediterranean". American Journal of Human Genetics. 83 (5): 633–42. doi:10.1016/j.ajhg.2008.10.012. PMC   2668035 . PMID   18976729.
  12. ↑ El-Sibai, M.; et al. (2009). "Geographical structure of the Y-chromosomal genetic landscape of the Levant: a coastal-inland contrast". Annals of Human Genetics. 73 (6): 568–81. doi:10.1111/j.1469-1809.2009.00538.x. PMC   3312577 . PMID   19686289.
  13. ↑ "Search". YHRD. Archived from the original on 2024-01-13.
  14. ↑ Biro, A.; Zalan, A.; et al. (2009). "A Y-Chromosomal Comparison of the Madjars (Kazakhstan) and the Magyars (Hungary)". American Journal of Physical Anthropology. 139 (3): 305–10. doi:10.1002/ajpa.20984. PMID   19170200. Archived from the original on 2013-01-05.
  15. ↑ "Report of Thomas Krahn".
  16. ↑ The Y Chromosome Consortium (2002). "A nomenclature system for the tree of human Y-chromosomal binary haplogroups". Genome Research. 12 (2): 339–48. doi:10.1101/gr.217602. PMC   155271 . PMID   11827954.
  17. ↑ "Haplogroup G Project results".
  18. 1 2 "Project Roster". Haplogroup G Project.
  19. ↑ Hammer, M.; et al. (2009). "Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood". Human Genetics. 126 (5): 719–24. doi:10.1007/s00439-009-0727-5. PMC   2771134 . PMID   19669163.
This page is based on this Wikipedia article
Text is available under the CC BY-SA 4.0 license; additional terms may apply.
Images, videos and audio are available under their respective licenses.