Amyloodinium ocellatum (Brown, 1931) is a cosmopolitanectoparasitedinoflagellate of numerous aquatic organisms living in brackish and seawater environments. The dinoflagellate is endemic in temperate and tropical areas, and is capable of successfully adapting to a variety of different environments and to a great number of hosts, having been identified in four phyla of aquatic organisms: Chordata, Arthropoda, Mollusca and Platyhelminthes. Moreover, it is the only dinoflagellate capable of infecting teleosts and elasmobranchs .
The parasite represents a serious problem for both reared and aquarium fish, since amyloodiniosis, the infection caused by this protozoan, can lead the host to death in less than 12 hours, with acute morbidity and mortality around 100%. However, these two parameters vary considerably on the basis of farming typology, parasite burden, fish species and season considered.[1] In general, amyloodiniosis is typically present in land- or lagoon-based rearing sites (valliculture or inland brackish farming), where shallow seabeds and poor water exchange/recirculation allow the parasite to reach its optimal proliferation values. Especially in the warmest months, A. ocellatum causes high mortality rates and economic damages.[2]
Simplified scheme of the life cycle of Amyloodinium ocellatum. (Dr P. Beraldo, University of Udine)
The lifecycle of A. ocellatum is direct and divided in three phases. In general, it can be completed in five to seven days when temperature and salinity are between 23-27°C and 30-35 ppt respectively. However, the parasite can also express its virulence in extreme conditions. In particular, lethal outbreaks were documented at high temperatures (more than 35°C) in both salt water (46 ppt) and brackish (7 ppt) environments.[1]
The parasitic stage is represented by the sessile trophont. In this phase, the protist is pear-shaped, enclosed in a cellulose wall and exhibits specific structures, rhizoids (tentacle like processes) that enable it to strictly anchor to host epithelia (gill or skin predominantly). If the infection is severe, trophonts can also be found on eyes, fins and in all oropharyngeal cavity, the latter is a typical infection site in the European seabass (Dicentrarchus labrax). Constantly moving while anchored and therefore causing physical injuries to cells, trophonts inflict serious damages to the host, potentially inducing its death in 12-48 hours as a function of the parasite burden. Based on data in the literature, the trophont feeds directly from the host cells, probably using the stomopode[clarification needed] by releasing digestive enzymes,[3] which exacerbate the rhizoid lesions. Trophont size can vary considerably, with early trophonts measuring 27×23 µm while mature ones can reach up to 130×60 µm and more.
Two to six days after feeding, the trophont detaches from the host and encysts on inert substrates (pond/tank bottom or seabed) transforming into the tomont: the reproductive stage. In this phase, the protozoan is round and encapsulated in a cellulose wall, which becomes thicker and confers upon it an exceptional resistance to unfavourable conditions and to several therapeutic treatments. The protozoan reproduces asexually, the first division is longitudinal while the succeeding ones are approximately regular and at right angles to each other. Potentially, in two to four days, from a single tomont, 256 new dinospores can be generated. The number of newly formed dinospores is directly correlated to the nutritive state of the trophont.[4]
The dinospore (8–13.5 × 10–12.5 μm), whose antero-posteriorly compressed shape resembles a hamburger, is the infective stage. In this phase, the armoured (cellulose wall) protist is capable of active swimming thanks to two flagella: one longitudinal, the other transverse. After adhesion to a new host, the dinospore transforms into a trophont within 5 to 20 minutes.[3]
Pathology and clinical signs
Trophont of Amyloodinium ocellatum anchored to European sea bass gill epithelium. (Dr. P. Beraldo, University of Udine)
A. ocellatum is the etiological agent of the so called “marine velvet disease” or amyloodiniosis (in the past it was also known as oodiniosis, as the protozoan was originally named Oodinium ocellatum). This infection is extremely dangerous and sometimes lethal for hosts, since it injures the animals and promotes secondary bacterial infections. All fish life stages may be susceptible if they are naïve to A. ocellatum. The protozoan pathogenicity is associated with the trophont attachment to host tissues; trophonts constantly twist and turn, slowly damaging and killing several host cells.[3] They inflict moderate-to-intense tissue reactions associated with serious gill hyperplasia, inflammation, haemorrhages and necrosis with subsequent death in less than 12 hours in heavy infected specimens. However, some mortalities were also documented in subclinical or mild infections as a probable consequence of osmoregulatory impairment and secondary microbial infections due to the serious epithelial damage.
Usually host behavioural changes are the first amyloodiniosis symptoms, represented by jerky movements (flashing), pruritus and dyspnoea with gathering at the water surface. Lethargy and anorexia appear in the advanced stages of the infection. Another clinical sign of amyloodiniosis could be the dusty appearance of the skin (hence the name “marine velvet disease”), as in European sea bass, but not in all fish species.
Impact
A. ocellatum represents a serious problem not only for reared fish but also for those kept in aquaria. Depending on interactions with farming typology, parasite burden, fish species and season, amyloodiniosis can lead the host to death in less than 12-48 hours, with acute morbidity and mortality around 100%. Generally, the infection affects land- or lagoon-based rearing sites (valliculture or inland brackish farming), whose characteristics (shallow seabeds and poor water exchange/recirculation) enable the parasite to best express its virulence. In the warmest months, when the parasite reaches its optimal proliferation rate, A. ocellatum is capable of causing high mortality rates and economic damage.
Diagnosis
A.ocellatum severe infection in European sea bass gills (Dr P. Beraldo, University of Udine)
Diagnosis of amyloodiniosis consists of observing typical clinical signs and using nonlethal techniques. A cytological approach by wet mount examinations of skin scrapes and gill biopsies is recommended to detect trophonts. Anaesthetized small-size fish can be directly observed under a stereomicroscope by gently lifting the opercular structure. The same approach can also be adopted for post-mortem fish, though it is better to examine fish that are freshly dead, as parasites often detach shortly after host death.[1][3] Dropping some diluted Lugol’s iodine onto skin or gills can help to improve A. ocellatum detection, since the iodine reacts with the starch-containing trophonts, colouring them in dark brown/black.[1]
Molecular identification can be applied as a second, confirmatory, diagnostic step in addition to clinical and microscopic identification. Recently developed molecular approaches (PCR and LAMP) have been proven to provide early detection of dinoflagellates in water and gill tissue samples, even when the parasite is present at lowest concentrations, such as in subclinical infections.[5] Therefore, these methods potentially allow for highly sensitive monitoring of pathogen load in susceptible fish populations.[1] Molecular diagnosis of A. ocellatum is based on primers AO18SF (5' GACCTTGCCCGAGAGGG 3') and AO18SR (5' GGTGTTAAGATTCACCACACTTTCC 3') for PCR amplification of a 248 bp segment of the 3’ end of the LSU rDNA gene.[6][5] Multiple sequence alignment using the CLUSTALw confirmed that sequenced AO was conserved with different geographic isolates from Mediterranean Sea (DQ490256.1), Red sea (DQ490257.1), Fujian-China (KU761581.1 and KR057921.1), Southern Mississippi-USA (JX905204.1).[6] However, these techniques are still limited to laboratory contexts.
In parallel, immunological approaches such as ELISA (enzyme linked immunosorbent assay) can detect the specific anti-A. ocellatum antibody levels[1][3] in fish recovering from amyloodiniosis outbreaks or that have been experimentally exposed to the parasite. The ELISA assay might be useful for monitoring levels of protection in susceptible populations, as elevated antibody titres have been associated with resistance.
Treatments
From the 1930s, several efforts have been performed to try to control amyloodiniosis in various fish species, but no treatment has proven to be totally effective or licensed worldwide. Early diagnosis followed by a prompt treatment is crucial as the protozoan has exponential reproductive potential in the warmest months, temperature affects how quickly the parasites multiply. Chemical treatments include formalin (36% formaldehyde at a concentration of 4mg/L for 7 hours or 51mg/L for 1 hour), hydrogen peroxide (75 and 150mg/L for 30min and repeated after 6 days), copper sulphate and chloroquine (5-10 mg/L water). However, only dinospores show significant susceptibility to some drugs, while trophonts and tomonts are more resistant.[1][3]
Copper sulphate is one of the most effective treatments to control A. ocellatum epidemics in aquaculture, due to the proven dinosporicide properties of the free copper ion, but also because it is inexpensive and easy to find.[7][8] The infusion of copper sulphate at 0.75-1 g/m3 for almost two weeks by dripping on ponds/tanks, maintaining constant copper concentration, is very effective to kill dinospores, while tomonts and trophonts are not very susceptible. Currently, copper sulphate is not approved by the European Regulation n. 1907/2006 (REACH) as amyloodiniosis treatment, despite its approval as an effective algaecide.
Freshwater baths are an effective way to detach trophonts from skin and gill epithelium due to the sudden osmotic shock experienced by the host.[1][3][8] However, freshwater bath procedures remain impractical for the majority of marine fish farms and some fish species cannot tolerate a similar treatment.
Other control strategies
Control strategies are intended as preventive measures to avoid dangerous outbreaks as A. ocellatum cannot be totally controlled. An effective filtration system and proper sanitation procedures (i.e. the use of UV rays combined with mechanical filtration of the intake water) can contribute to reducing the risk of the infection. It is important to emphasise that dinospores can be transported through aerosol droplets,[9] therefore contaminating farm equipment and/or contiguous ponds/tanks as well as nearby facilities if spread by strong winds. For this reason, scrupulous disinfection protocols of materials and adequate management practices should be considered mandatory in farms.
Another aspect that can be taken into account is the choice of an appropriate rearing site. Parasitosis can be influenced by its characteristics. Normally, sea cage reared fish are not affected by the infection, while it is more difficult to control the infection in valliculture or inland brackish farming systems.
Prevention of the disease by vaccination is not possible, although some studies are in progress to identify potential vaccine candidate proteins, i.e. i-antigens, of the parasite. Fish that survive amyloodiniosis may develop at least a partial immunity.
Research
Since 1931 (year of the first A. ocellatum report), numerous investigations have been conducted. The biology and ecology of the protozoan were precisely described between the 1930s and 1940s and elaborated in the following decades. In 1984, Paperna[4] determined the environmental characteristics influencing the virulence of A. ocellatum in its three stages. Three years later, Noga successfully established an in vitro propagation protocol, which was fundamental for the implementation of important laboratory surveys. An alternative to this protocol, based on in vitro maintenance of tomonts’ in a hibernation status, was recently developed by a group of researchers of the University of Udine within the Horizon2020Project ParaFishControl. Within the framework of this project, researchers are currently investigating alternative therapeutants and developing more targeted prophylaxis measures against the protozoan. Although ambitious, the aim of the project is to create a vaccine against A. ocellatum.
Related Research Articles
Ichthyophthirius multifiliis, often termed "Ich", is a parasitic ciliate described by the French parasitologist Fouquet in 1876. Only one species is found in the genus which also gave name to the family. The name literally translates as "the fish louse with many children". The parasite can infect most freshwater fish species and, in contrast to many other parasites, shows low host specificity. It penetrates gill epithelia, skin and fins of the fish host and resides as a feeding stage inside the epidermis. It is visible as a white spot on the surface of the fish but, due to its internal microhabitat, it is a true endoparasite and not an ectoparasite.
Perkinsus marinus is a species of alveolate belonging to the phylum Perkinsozoa. It is similar to a dinoflagellate. It is known as a prevalent pathogen of oysters, causing massive mortality in oyster populations. The disease it causes is known as dermo or perkinsosis, and is characterized by the degradation of oyster tissues. The genome of this species has been sequenced.
Myxobolus cerebralis is a myxosporean parasite of salmonids that causes whirling disease in farmed salmon and trout and also in wild fish populations. It was first described in rainbow trout in Germany in 1893, but its range has spread and it has appeared in most of Europe, the United States, South Africa, Canada and other countries from shipments of cultured and wild fish. In the 1980s, M. cerebralis was found to require a tubificid oligochaete to complete its life cycle. The parasite infects its hosts with its cells after piercing them with polar filaments ejected from nematocyst-like capsules. This infects the cartilage and possibly the nervous tissue of salmonids, causing a potentially lethal infection in which the host develops a black tail, spinal deformities, and possibly more deformities in the anterior part of the fish.
Velvet disease is a fish disease caused by dinoflagellate parasites of the genera Amyloodinium in marine fish, and Oodinium in freshwater fish. The disease gives infected organisms a dusty, brownish-gold color. The disease occurs most commonly in tropical fish, and to a lesser extent, marine aquaria. Periodic use of preventive treatments like aquarium salt can further deter parasites. Regular monitoring, attentive care, and preventive measures collectively contribute to keeping Goldfish health and Velvet-free.
Cryptocaryon irritans is a species of ciliates that parasitizes marine fish, causing marine white spot disease or marine ich. It is one of the most common causes of disease in marine aquaria.
Enteric redmouth disease, or simply redmouth disease is a bacterial infection of freshwater and marine fish caused by the pathogen Yersinia ruckeri. It is primarily found in rainbow trout and other cultured salmonids. The disease is characterized by subcutaneous hemorrhaging of the mouth, fins, and eyes. It is most commonly seen in fish farms with poor water quality. Redmouth disease was first discovered in Idaho rainbow trout in the 1950s. The disease does not infect humans.
Bath treatments are easy to carry out disease treatments that originated since the earliest days of goldfish culture. One of the most effective procedure is called the salt bath which is quite effective in eradicating ciliated parasites from the fish. However, there are also useless, thus not recommended, bath treatments such as the use of certain antibiotics or vitamins in the bath. Bath treatment can either be short-term or long-term.
Like humans and other animals, fish suffer from diseases and parasites. Fish defences against disease are specific and non-specific. Non-specific defences include skin and scales, as well as the mucus layer secreted by the epidermis that traps microorganisms and inhibits their growth. If pathogens breach these defences, fish can develop inflammatory responses that increase the flow of blood to infected areas and deliver white blood cells that attempt to destroy the pathogens.
Hematodinium is a genus of dinoflagellates. Species in this genus, such as Hematodinium perezi, the type species, are internal parasites of the hemolymph of crustaceans such as the Atlantic blue crab and Norway lobster. Species in the genus are economically damaging to commercial crab fisheries, including causing bitter crab disease in the large Tanner or snow crab fisheries of the Bering Sea.
Amoebophyra is a genus of dinoflagellates. Amoebophyra is a syndinian parasite that infects free-living dinoflagellates that are attributed to a single species by using several host-specific parasites. It acts as "biological control agents for red tides and in defining species of Amoebophrya." Researchers have found a correlation between a large amount of host specify and the impact host parasites may have on other organisms. Due to the host specificity found in each strain of Amoebophrya's physical makeup, further studies need to be tested to determine whether the Amoebophrya can act as a control against harmful algal blooms.
Copper alloys are important netting materials in aquaculture. Various other materials including nylon, polyester, polypropylene, polyethylene, plastic-coated welded wire, rubber, patented twine products, and galvanized steel are also used for netting in aquaculture fish enclosures around the world. All of these materials are selected for a variety of reasons, including design feasibility, material strength, cost, and corrosion resistance.
Betanodavirus, or nervous necrosis virus (NNV), is a genus of nonenveloped positive-strand RNA viruses in the family Nodaviridae. Member viruses infect fish and cause viral nervous necrosis (VNN) and viral encephalopathy and retinopathy (VER). The genus contains four species.
Piscirickettsia salmonis is the bacterial causative agent of piscirickettsiosis, an epizootic disease in salmonid fishes. It has a major impact on salmon populations, with a mortality rate of up to 90% in some species. The type strain, LF-89, is from Chile, but multiple strains exist, and some are more virulent than others. P. salmonis and piscrickettsiosis are present in various geographic regions from Europe to Oceania to South America, but the Chilean salmon farming industry has been particularly hard-hit. Different strategies of controlling the disease and farm-to-farm spread have been the subject of much research, but a significant amount is still unknown.
Tenacibaculum is a Gram-negative and motile bacterial genus from the family of Flavobacteriaceae.
Miamiensis avidus is a species of unicellular marine eukaryote that is a parasite of many different types of fish. It is one of several organisms known to cause the fish disease scuticociliatosis and is considered an economically significant pathogen of farmed fish. M. avidus is believed to be the cause of a 2017 die-off of fish and sharks in the San Francisco Bay.
Philasterides dicentrarchi is a marine protozoan ciliate that was first identified in 1995 after being isolated from infected European sea bass reared in France. The species was also identified as the causative agent of outbreaks of scuticociliatosis that occurred between summer 1999 and spring 2000 in turbot cultivated in the Atlantic Ocean. Infections caused by P. dicentrarchi have since been observed in turbot reared in both open flow and recirculating production systems. In addition, the ciliate has also been reported to cause infections in other flatfishes, such as the olive flounder in Korea and the fine flounder in Peru, as well as in seadragons, seahorses, and several species of sharks in other parts of the world.
Scuticociliatosis is a severe and often fatal parasitic infection of several groups of marine organisms. Species known to be susceptible include a broad range of teleosts, seahorses, sharks, and some crustaceans. The disease can be caused by any one of about 20 distinct species of unicellular eukaryotes known as scuticociliates, which are free-living marine microorganisms that are opportunistic or facultative parasites. Scuticociliatosis has been described in the wild, in captive animals in aquariums, and in aquaculture. It is best studied in fish species that are commonly farmed, in which typical effects of infection include skin ulceration, hemorrhage, and necrosis, with post-mortem examination identifying ciliates in the skin, gills, blood, and internal organs including the brain.
Sparicotyle chrysophrii is a species of monogenean, parasitic on the gills of the marine fish. It belongs to the family Microcotylidae. Its type-host is the gilt-head seabream.
Enteromyxum leei is a species of myxozoan, histozoic parasite that infects the intestinal tract and sometimes associated organs, like gall bladder and liver, of several teleostean fish species. Myxozoans are microscopic metazoans, with an obligate parasitic life-style. The parasite stages of this species live in the paracelullar space between fish enterocytes. It is the causative agent of enteromyxosis, or emaciative disease, also known as "razor blade syndrome" in sparid fish. E. leei has a wide host and geographical range within marine fish, and even freshwater fish have been infected experimentally. E. leei initially emerged in the Mediterranean in the late 1980s and it is believed to have been unintentionally introduced into the Red Sea. Its pathogenicity and economic impact depend on the host species. In the gilt-head seabream, it is manifested as a chronic disease that provokes anorexia, delayed growth with weight loss, cachexia, reduced marketability and increased mortality. In other species, it has no clinical signs. In sharpsnout seabream, infection results in very high mortality rates, which have pushed fish farmers to abandon the culture of this fish species.
Ceratothoa oestroides is a crustacean isopod, obligate ectoparasite of marine fish that dwells in the buccal cavity. It is the causative agent of various pathologies including tissue damage at the parasitisation site (tongue), growth defects, decrease in mean host weight and size and increases mortalities in farmed and wild fish populations. It has been recorded in six different fish families: Sparidae, Carangidae, Clupeidae, Maenidae, Scorpenidae, and Mugilidae.
References
1 2 3 4 5 6 7 8 Noga, E. J. (2012). Amyloodinium ocellatum. In: Woo P.T.K., Buchman, K. (Eds), Fish parasites: Pathobiology and protection. Croydon: CAB International. pp.383pp.
↑ Soares, F.; Quental Ferreira, H.; Cunha, E.; Pousão-Ferreira, P. (2011). "Occurrence of Amyloodinium ocellatum in aquaculture fish production: a serious problem in semi-intensive earthen ponds". Aquaculture Europe. 36 (4): 13–16.
1 2 3 4 5 6 7 Noga, E. J.; Levy, M. G. (2006). Phylum Dinoflagellata. In: Woo P.T.K. (Eds), Fish Diseases and Disorders, Volume 1: Protozoan and Metazoan Infections Second Edition. King's Lynn: CAB International. pp.791pp.
1 2 Byadgi, Omkar; Beraldo, Paola; Volpatti, Donatella; Massimo, Michela; Bulfon, Chiara; Galeotti, Marco (2019-01-01). "Expression of infection-related immune response in European sea bass (Dicentrarchus labrax) during a natural outbreak from a unique dinoflagellate Amyloodinium ocellatum". Fish & Shellfish Immunology. 84: 62–72. doi:10.1016/j.fsi.2018.09.069. ISSN1050-4648. PMID30266602. S2CID52884569.
↑ Paperna, Ilan (1984-04-15). "Chemical control of Amyloodinium ocellatum (Brown 1931) (Dinoflagellida) infections: In vitro tests and treatment trials with infected fishes". Aquaculture. 38 (1): 1–18. doi:10.1016/0044-8486(84)90133-9. ISSN0044-8486.
↑ Roberts-Thomson, Ashley; Barnes, Andrew; Fielder, D. Stewart; Lester, Robert J. G.; Adlard, Robert D. (2006-06-30). "Aerosol dispersal of the fish pathogen, Amyloodinium ocellatum". Aquaculture. 257 (1): 118–123. doi:10.1016/j.aquaculture.2006.02.058. ISSN0044-8486.
Further reading
Francis-Floyd, Ruth, and Maxine R. Floyd. Amyloodinium ocellatum, an important parasite of cultured marine fish. Southern Regional Aquaculture Center, 2011.
This page is based on this Wikipedia article Text is available under the CC BY-SA 4.0 license; additional terms may apply. Images, videos and audio are available under their respective licenses.
