| FOCAD | |||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Identifiers | |||||||||||||||||||||||||||||||||||||||||||||||||||
| Aliases | FOCAD , KIAA1797, focadhesin | ||||||||||||||||||||||||||||||||||||||||||||||||||
| External IDs | OMIM: 614606 MGI: 2676921 HomoloGene: 9842 GeneCards: FOCAD | ||||||||||||||||||||||||||||||||||||||||||||||||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||
| Wikidata | |||||||||||||||||||||||||||||||||||||||||||||||||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||
KIAA1797 is a protein that in humans is encoded by the KIAA1797 gene. [5]
A specific single-nucleotide polymorphism rs7875153 in KIAA1797 is associated with heart rate. [6]
KIAA1797 is a protein-coding gene in Homo sapiens. Alternate names for the gene are FLJ20375, OTTHUMP00000069845, and hypothetical protein LOC54914. [5] Located on chromosome 9 at area p21.3, [7] the entire gene including introns and exons is 375,010 base pairs on the plus strand. There are 19 alternative splice variants. Longest variant yields an mRNA of 6117 base pairs.
KIAA1797 was determined to express ubiquitously at varying levels throughout the human body. Based on the EST profile of Unigene, KIAA1797 expression has been observed in tissues ranging from reproductive to secretory. [8]
Predicted secondary mRNA structures in the 5'UTR and the 3'UTR are ugagaugaacucgguaucuca and uccuaagagaggag, respectively. Other possible secondary structures are shown in the table below.
The main isoform of the human protein is 1801 amino acids long, a total of 200,072 Da. [7]
Two distinct domains of unknown function (DUF) are found in the sequence. DUF3730 (465-682aa) appears two times in the sequence; this domain family is found in eukaryotes and is typically between 220 and 262 amino acids in length. DUF3028(1213-1801aa). No additional information was available regarding this DUF.
KIAA1797 is well conserved in mammals, but it is also found in nonmammalians with lower sequence identities.
KIAA1797 is downstream of MLLT3 and upstream of PTPLAD2. MLLT3 is involved with myeloid/lymphoid or mixed-lineage leukemia. PTPLAD2 is a protein tyrosine phosphatase.
The exact function of KIAA1797 is not yet understood by the scientific community. It is, however, found to be a transmembrane protein.
Nesprin-2 is a protein that in humans is encoded by the SYNE2 gene. The human SYNE2 gene consists of 116 exons and encodes nesprin-2, a member of the nuclear envelope (NE) spectrin-repeat (nesprin) family. Nesprins are modular proteins with a central extended spectrin-repeat (SR) rod domain and a C-terminal Klarsicht/ANC-1/Syne homology (KASH) transmembrane domain, which acts as a NE-targeting motif. Nesprin-2 (Nesp2) binds to cytoplasmic F-actin, tethering the nucleus to the cytoskeleton and maintaining the structural integrity of the nucleus.
Eukaryotic initiation factor 4A-III is a protein that in humans is encoded by the EIF4A3 gene.
Probable leucyl-tRNA synthetase, mitochondrial is an enzyme that in humans is encoded by the LARS2 gene.
RNA-binding protein 12 is a protein that in humans is encoded by the RBM12 gene.
Isoleucyl-tRNA synthetase, cytoplasmic is an enzyme that in humans is encoded by the IARS1 gene.
Uncharacterized protein KIAA1109 is a protein that in humans is encoded by the KIAA1109 gene.
Ribosomal RNA-processing protein 8 is a protein that in humans is encoded by the RRP8 gene.
Transmembrane protein 63A is a protein that in humans is encoded by the TMEM63A gene. The mature human protein is approximately 92.1 kilodaltons (kDa), with a relatively high conservation of mass in orthologs. The protein contains eleven transmembrane domains and is inserted into the membrane of the lysosome. BioGPS analysis for TMEM63A in humans shows that the gene is ubiquitously expressed, with the highest levels of expression found in T-cells and dendritic cells.
TOX4 also known as KIAA0737, is a human gene.
The CD302 antigen also known as C-type lectin domain family 13 member A is a protein that in humans is encoded by the CD302 gene.
Uncharacterized protein KIAA0895-like also known as LOC653319, is a protein that in humans is encoded by the KIAA0895L gene.
KIAA0644, also known as TRIL or TLR4 interactor with leucine rich repeats, is a protein that in humans is encoded by the KIAA0644 gene.
KIAA0895 is a protein that in Homo sapiens is encoded by the KIAA0895 gene. The gene encodes a protein commonly known as the KIAA0895 protein. It's aliases include hypothetical protein LOC23366, OTTHUMP00000206979, OTTHUMP00000206980, 9530077C05Rik, and 1110003N12Rik. It is located at 7p14.2.
KIAA1704, also known as LSR7, is a protein that in humans is encoded by the GPALPP1 gene. The function of KIAA1704 is not yet well understood. KIAA1704 contains one domain of unknown function, DUF3752. The protein contains a conserved, uncharged, repeated motif GPALPP(GF) near the N terminus and an unusual, conserved, mixed charge throughout. It is predicted to be localized to the nucleus.
Tetratricopeptide repeat 39A is a human protein encoded by the TTC39A gene. TTC39A is also known as DEME-6, KIAA0452, and c1orf34. The function of TTC39A is currently not well understood. The main feature within tetratricopeptide repeat 39A is the domain of unknown function 3808 (DUF3808), spanning almost the entire protein. KIAA0452 can also be seen as an isoform of TTC39A because of differences in genome sequence, but overlap in DUF domain.
Transmembrane protein 131-like, alternatively named uncharacterized protein KIAA0922, is an integral transmembrane protein encoded by the human gene KIAA0922 that is significantly conserved in eukaryotes, at least through protists. Although the function of this gene is not yet fully elucidated, initial microarray evidence suggests that it may be involved in immune responses. Furthermore, its paralog, prolyl endopeptidase (PREP) whose function is known, provides clues as to the function of TMEM131L.
TM6SF2 is the Transmembrane 6 superfamily 2 human gene which codes for a protein by the same name. This gene is otherwise called KIAA1926. Its exact function is currently unknown.
The FAM214B, also known as protein family with sequence similarity 214, B (FAM214B) is a protein that, in humans, is encoded by the FAM214B gene located on the human chromosome 9. The protein has 538 amino acids. The gene contain 9 exon. There has been studies that there are low expression of this gene in patients with major depression disorder. In most organisms such as mammals, amphibians, reptiles, and birds, there are high levels of gene expression in the bone marrow and blood. For humans in fetal development, FAM214B is mostly expressed in the brains and bone marrow.
KIAA2013, also known as Q8IYS2 or MGC33867, is a single-pass transmembrane protein encoded by the KIAA2013 gene in humans. The complete function of KIAA2013 has not yet been fully elucidated.
KIAA1143 is an uncharacterized protein in humans that is encoded by the KIAA1143 gene. it may play a role in cell growth mechanisms and regulation/creation of cytoskeletal structure. This gene is located on chromosome 3 on the minus strand
 | This article on a gene on human chromosome 9 is a stub. You can help Wikipedia by expanding it. |
