KIAA1797

FOCAD
Identifiers
Aliases	FOCAD , KIAA1797, focadhesin
External IDs	OMIM: 614606; MGI: 2676921; HomoloGene: 9842; GeneCards: FOCAD; OMA:FOCAD - orthologs
Gene location (Human)
Chr.	Chromosome 9 (human)
End	20,995,955 bp
Gene location (Mouse)
Chr.	Chromosome 4 (mouse)
End	88,411,011 bp
RNA expression pattern
	Top expressed in
	Epithelium of choroid plexus; ; middle temporal gyrus; ; parotid gland; ; Brodmann area 23; ; epithelium of bronchus; ; bronchial epithelial cell; ; epithelium of colon; ; islet of Langerhans; ; endothelial cell; ; pituitary gland;
	Top expressed in
	zygote; ; facial motor nucleus; ; granulocyte; ; primary oocyte; ; gastrula; ; superior frontal gyrus; ; lateral septal nucleus; ; spermatocyte; ; spermatid; ; secondary oocyte;
	More reference expression data
	n/a
Orthologs
	54914
	230393
	ENSG00000188352
	ENSMUSG00000038368
	Q5VW36
	A2AKG8
	NM_017794 ; NM_001375567 ; NM_001375568 ; NM_001375570
	NM_001081184
	NP_060264 ; NP_001362496 ; NP_001362497 ; NP_001362499
	NP_001074653
	Wikidata
View/Edit Human	View/Edit Mouse

Last updated July 18, 2025

KIAA1797 is a protein that in humans is encoded by the KIAA1797 gene.^[5]

Gene

KIAA1797 is a protein-coding gene in Homo sapiens. Alternate names for the gene are FLJ20375, OTTHUMP00000069845, and hypothetical protein LOC54914.^[5] Located on chromosome 9 at area p21.3,^[7] the entire gene including introns and exons is 375,010 base pairs on the plus strand. There are 19 alternative splice variants. Longest variant yields an mRNA of 6117 base pairs.

Expression

KIAA1797 was determined to express ubiquitously at varying levels throughout the human body. Based on the EST profile of Unigene, KIAA1797 expression has been observed in tissues ranging from reproductive to secretory.^[8]

mRNA

Predicted secondary mRNA structures in the 5'UTR and the 3'UTR are ugagaugaacucgguaucuca and uccuaagagaggag, respectively. Other possible secondary structures are shown in the table below.

Protein sequence

The main isoform of the human protein is 1801 amino acids long, a total of 200,072 Da.^[7]

Two distinct domains of unknown function (DUF) are found in the sequence. DUF3730 (465-682aa) appears two times in the sequence; this domain family is found in eukaryotes and is typically between 220 and 262 amino acids in length. DUF3028(1213-1801aa). No additional information was available regarding this DUF.

Homology

KIAA1797 is well conserved in mammals, but it is also found in nonmammalians with lower sequence identities.

Gene neighborhood

KIAA1797 is downstream of MLLT3 and upstream of PTPLAD2. MLLT3 is involved with myeloid/lymphoid or mixed-lineage leukemia. PTPLAD2 is a protein tyrosine phosphatase.

Function

The exact function of KIAA1797 is not yet understood by the scientific community. It is, however, found to be a transmembrane protein.

References

1 2 3 GRCh38: Ensembl release 89: ENSG00000188352 – Ensembl, May 2017
1 2 3 GRCm38: Ensembl release 89: ENSMUSG00000038368 – Ensembl, May 2017
↑ "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
↑ "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
1 2 "Entrez Gene: KIAA1797".
↑ Melton PE, Rutherford S, Voruganti VS, Göring HH, Laston S, Haack K, Comuzzie AG, Dyer TD, Johnson MP, Kent JW, Curran JE, Moses EK, Blangero J, Barac A, Lee ET, Best LG, Fabsitz RR, Devereux RB, Okin PM, Bella JN, Broeckel U, Howard BV, MacCluer JW, Cole SA, Almasy L (September 2010). "Bivariate genetic association of KIAA1797 with heart rate in American Indians: the Strong Heart Family Study". Hum. Mol. Genet. 19 (18): 3662–71. doi:10.1093/hmg/ddq274. PMC 2928129 . PMID 20601674.
1 2 AceView NCBI Gene Information AceView Archived November 28, 2005, at the Wayback Machine
↑ "EST Profile – Hs.283322". National Center for Biotechnology Information, United States National Library of Medicine. Archived from the original on January 30, 2016.

Rose JE, Behm FM, Drgon T, et al. (2010). "Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score". Mol. Med. 16 (7–8): 247–53. doi:10.2119/molmed.2009.00159. PMC 2896464 . PMID 20379614.
Chapuis J, Hot D, Hansmannel F, et al. (2009). "Transcriptomic and genetic studies identify IL-33 as a candidate gene for Alzheimer's disease". Mol. Psychiatry. 14 (11): 1004–16. doi:10.1038/mp.2009.10. PMC 2860783 . PMID 19204726.
Maruyama K, Sugano S (1994). "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides". Gene. 138 (1–2): 171–4. doi:10.1016/0378-1119(94)90802-8. PMID 8125298.
Nagase T, Nakayama M, Nakajima D, et al. (2001). "Prediction of the coding sequences of unidentified human genes. XX. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro". DNA Res. 8 (2): 85–95. doi: 10.1093/dnares/8.2.85 . PMID 11347906.

This article on a gene on human chromosome 9 is a stub. You can help Wikipedia by expanding it.

This page is based on this Wikipedia article
Text is available under the CC BY-SA 4.0 license; additional terms may apply.
Images, videos and audio are available under their respective licenses.

[refGRCh38Ensembl-1] 1 2 3 GRCh38: Ensembl release 89: ENSG00000188352 – Ensembl, May 2017

[refGRCm38Ensembl-2] 1 2 3 GRCm38: Ensembl release 89: ENSMUSG00000038368 – Ensembl, May 2017

[3] "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.

[4] "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.

[entrez-5] 1 2 "Entrez Gene: KIAA1797".

[pmid20601674-6] Melton PE, Rutherford S, Voruganti VS, Göring HH, Laston S, Haack K, Comuzzie AG, Dyer TD, Johnson MP, Kent JW, Curran JE, Moses EK, Blangero J, Barac A, Lee ET, Best LG, Fabsitz RR, Devereux RB, Okin PM, Bella JN, Broeckel U, Howard BV, MacCluer JW, Cole SA, Almasy L (September 2010). "Bivariate genetic association of KIAA1797 with heart rate in American Indians: the Strong Heart Family Study". Hum. Mol. Genet. 19 (18): 3662–71. doi:10.1093/hmg/ddq274. PMC 2928129 . PMID 20601674.

[AceView-7] 1 2 AceView NCBI Gene Information AceView Archived November 28, 2005, at the Wayback Machine

[urlEST_Profile_–_Hs.283322-8] "EST Profile – Hs.283322". National Center for Biotechnology Information, United States National Library of Medicine. Archived from the original on January 30, 2016.

[1]

[2]

[3]

[4]

[5]

[6]

[7]

[8]