Haplogroup G-FGC7535

Last updated
Haplogroup G-FGC7535 (G2a1)
Possible time of originabout 3,000 years BC
Possible place of originpossibly South Caucasus region
AncestorHaplogroup G2a
DescendantsG2a1a
Defining mutationsFGC7535/SK1106/Z6552

Haplogroup G-FGC7535, also known as Haplogroup G2a1 (and formerly G-L293), [1] is a Y-chromosome haplogroup. It is an immediate descendant of G2a (G-P15), which is a primary branch of haplogroup G2 (P287).

Contents

G2a1 has an extremely low frequency in almost all populations except parts of the Caucasus Mountains.

In 2017, the SNP L293 was replaced by FGC7535, SK1106 and Z6552 as the defining SNPs of G2a1, due to the technical difficulty in testing for L293. [1]

Genetic features of haplogroup G2a1

Almost all G2a1 persons have a value of 10 at short tandem repeat (STR) marker DYS392. The major G2a1 subgroup typically has higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. Almost all G2a1a persons have a value of 15 or more at DYS385a, a finding which can be helpful in distinguishing G2a1a persons from non-G persons with similar marker values. In addition, the G2a1a persons tested were found to have a value of 9 at marker DYS505. This is several values below what is found in G subgroups, and is potentially the basis of additional subgrouping.

L293 which defines G2a1 is a SNP first identified at Family Tree DNA in 2011, and in 2012 was determined to encompass P16 positive persons. L293 is found at chromosome position 10595022 and represents a mutation from G to C. The forward primer is GTCCAGCTCATATGTCTTCAG, and the reverse primer is GACTTTCAACTTCTTACGGCTG. [2] Under usual circumstances subgroup G2a1a persons would also have the distinctive mutation at SNP P16 that characterizes G2a1a. The reliability of P16 in identifying everyone who should be P16+ has been questioned. [3] Because there are two strands involved, P16 results can be reported as P16.1 and P16.2, and persons may have varying results for components of the SNP. The P designation in P16 indicates it was identified at the University of Arizona, and P16's existence was first reported in 2000. [4] These are the specifications listed for P16: located on the Y chromosome at 19434578; 19128376.....forward primer is aggctccatctgtagcacac.....reverse primer is taaccttatagaccaaccccg...the mutation is a change from A to T. [5]

Dating of G2a1 origin

The only published study to date P16 (G2a1a) argues it is about 9,600 years old. [6]

G2a1 subgroups

G2a1a (P16) and G2a1a1 (P18)

The presence of the SNP P16 mutation characterizes G2a1's only SNP subgroup, G2a1a. But it is difficult to distinguish P16 from its own P18 subgroup. The reliability of P16 in identifying everyone in its G2a1a category has been questioned. [3] As to P18, because individual strands are examined, P18 can be classified as P18.1, P18.2 and P18.3, and persons may have varying results for three components. The P designation indicates it was identified at the University of Arizona, and its existence was first reported in 2002. [7] The technical specifications for P18 are that it is: located on the Y chromosome at 25751219; 25029753; 23396005....forward primer is tggatctgattcacaggtag....reverse primer is ccaacaatatgtcacaatctc.....the mutation is a change from C to T. [5]

Other G2a1a genetic clusters

Due to the unreliability of the SNP testing for this haplogroup, it can be difficult to validate whether identificable clusters of men belong to G2a1a or instead to G2a1a1. The most common cluster based on STR marker values of G2a1a men who report ancestry in the Caucasus Mountains region has the value of 9 at STR marker DYS391 and 19,21 at marker YCA. Significant other smaller G2a1a Caucasus clusters with 10 or 11 at DYS391 also exist.

The Ashkenazi Jewish G2a1a men with northeastern European origins almost all have YCA values of 21,21 and a DYS19 value of 16. More variation in values is seen in the Caucasus samples than the Ashkenazi samples, suggesting an older common ancestor in the Caucasus than among the Jews.

Other G2a1a men reporting eastern European ancestry form a cluster with YCA values of 19,21 without the other distinctive values seen in the other two clusters.

About half of the available G2a1a/G2a1a1 samples do not reliably belong to any of these three clusters. In addition, the STR markers mentioned are prone to further mutations and are not as reliable as SNPs in identifying all the persons who share a common male ancestor.

Finally, there are lesser numbers of G2a1 men who are negative for P16. It is unclear whether their ancestors may have ever had the P16 mutation. Many of these men have a very unusual 13,21 value for marker YCA and are predominantly Hispanic.

Geographic distribution

G2a1a and its one subgroup represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. G2a1a is found only in tiny numbers elsewhere. A recent article by Balanovsky et al. [8] provided the first detailed testing of P16 and P18 in this region.

Almost all P16 samples also had the P18 mutation. The highest percentage of P18 was found among Ossetians of Russia's Republic of North Ossetia–Alania, representing 32% of all samples there. Among Abkhazians of Abkhazia, P18 was 16% of total samples, and it was 8% of Circassians (Adyghe) in Russia's Republic of Karachay–Cherkess. Elsewhere in the Caucasus, P16 and P18 were negligible or represented a small percentage. The southeastern Caucasus area was not sampled.

There are isolated samples of G2a1a men with reported ancestry in Georgia, Turkey, Bulgaria, western Russia, Libya, and England with similarities to those of a North Ossetian cluster based on STR marker values. The Svans and South Ossetians within Georgia have significant G2a1a presence though no one has yet quantified the percentage. Likewise closely related to a Jewish cluster based on STR marker values is an anonymous sample in the SMGF database from Kashgar, China, [9] as well as isolated samples from Lebanon, Cyprus, Armenia and the Austrian Tyrol. The mostly eastern European YCA=19,21 subgroup includes an anonymous sample in the SMGF database [9] from Kyrgyzstan, and another sample from among the Svans of Georgia exists.

There are also isolated samples that do not belong to any cluster from the major countries of central, eastern and southern Europe, from Morocco, the northern Middle East, the Caucasus region and Iran. [10] The sample from Iran (Tehran) represents only 1 of the 444 Iranian samples of all types in the YHRD database. Possibly of significance—unlike some other G subgroups—G2a1 samples from southern Asia do not seem to exist. [11] In contrast, among the Romani of Hungary many of the available haplogroup G samples have STR marker features typical of G2a1a. [12]

Famous members

Joseph Stalin, from genetic testing of his grandson (his son Vasily's son; Alexander Burdonsky) belongs to haplogroup G2a1a1. [13] The STR marker value combinations for him are typical of those seen primarily in the Caucasus region. [10] Richard III of England was confirmed just prior to his re-interment to be a member of haplogroup G2 > G-P287, despite the low frequency of this haplogroup in modern Great Britain.[ citation needed ]

See also

Related Research Articles

Y-chromosomal Aaron is the name given to the hypothesized most recent common ancestor of the patrilineal Jewish priestly caste known as Kohanim. According to the traditional understanding of the Hebrew Bible, this ancestor was Aaron, the brother of Moses. A historical-critical reading of the biblical text suggests that the origin of the priesthood could have been much more complex, and that for much if not all of the First Temple period, kohen may have not (necessarily) synonymous with "Aaronide". Rather, this traditional identity seems to have been adopted sometime around the second temple period.

<span class="mw-page-title-main">Haplotype</span> Group of genes from one parent

A haplotype is a group of alleles in an organism that are inherited together from a single parent.

Genetic genealogy is the use of genealogical DNA tests, i.e., DNA profiling and DNA testing, in combination with traditional genealogical methods, to infer genetic relationships between individuals. This application of genetics came to be used by family historians in the 21st century, as DNA tests became affordable. The tests have been promoted by amateur groups, such as surname study groups or regional genealogical groups, as well as research projects such as the Genographic Project.

A genealogical DNA test is a DNA-based genetic test used in genetic genealogy that looks at specific locations of a person's genome in order to find or verify ancestral genealogical relationships, or to estimate the ethnic mixture of an individual. Since different testing companies use different ethnic reference groups and different matching algorithms, ethnicity estimates for an individual vary between tests, sometimes dramatically.

<span class="mw-page-title-main">Haplogroup G-M201</span> Human Y chromosome DNA grouping common in western Eurasia

Haplogroup G (M201) is a human Y-chromosome haplogroup. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK.

<span class="mw-page-title-main">Human Y-chromosome DNA haplogroup</span> Human DNA groupings

In human genetics, a human Y-chromosome DNA haplogroup is a haplogroup defined by specific mutations in the non-recombining portions of DNA on the male-specific Y chromosome (Y-DNA). Individuals within a haplogroup share similar numbers of short tandem repeats (STRs) and single-nucleotide polymorphisms (SNPs). The Y-chromosome accumulates approximately two mutations per generation, and Y-DNA haplogroups represent significant branches of the Y-chromosome phylogenetic tree, each characterized by hundreds or even thousands of unique mutations.

Haplogroup R2a, or haplogroup R-M124, is a Y-chromosome haplogroup characterized by genetic markers M124, P249, P267, L266, and is mainly found in South Asia as well as in Central Asia, Caucasus, West Asia and North Africa / MENA.

Haplogroup I-M438, also known as I2, is a human DNA Y-chromosome haplogroup, a subclade of haplogroup I-M170. Haplogroup I-M438 originated some time around 26,000–31,000 BCE. It originated in Europe and developed into several main subgroups: I2-M438*, I2a-L460, I2b-L415 and I2c-L596. The haplogroup can be found all over Europe and reaches its maximum frequency in the Dinaric Alps (Balkans) via founder effect, related to the migrations of the Early Slavs to the Balkan peninsula.

In genetic genealogy, a unique-event polymorphism (UEP) is a genetic marker that corresponds to a mutation that is likely to occur so infrequently that it is believed overwhelmingly probable that all the individuals who share the marker, worldwide, will have inherited it from the same common ancestor, and the same single mutation event.

The Sorenson Molecular Genealogy Foundation (SMGF) was an independent DNA and genealogical research institution with the goal of demonstrating how the peoples of the world are related. SMGF collected DNA samples and genealogical information from individuals across the globe to establish these connections.

<span class="mw-page-title-main">Haplogroup R1b</span> Type of paternal lineage

Haplogroup R1b (R-M343), previously known as Hg1 and Eu18, is a human Y-chromosome haplogroup.

<span class="mw-page-title-main">Haplogroup G-M285</span> Human Y-chromosome DNA haplogroup

In human genetics, Haplogroup G-M285 or G-M342, also known as Haplogroup G1, is a Y-chromosome haplogroup. Haplogroup G1 is a primary subclade of haplogroup G.

In human genetics, Haplogroup G-P303 is a Y-chromosome haplogroup. It is a branch of haplogroup G (Y-DNA) (M201). In descending order, G-P303 is additionally a branch of G2 (P287), G2a (P15), G2a2, G2a2b, G2a2b2, and finally G2a2b2a. This haplogroup represents the majority of haplogroup G men in most areas of Europe west of Russia and the Black Sea. To the east, G-P303 is found among G persons across the Middle East, Iran, the southern Caucasus area, China, and India. G-P303 exhibits its highest diversity in the Levant.

In human genetics, Haplogroup G-M406 is a Y-chromosome haplogroup. G-M406 is a branch of Haplogroup G Y-DNA (M201). More specifically in descending order, G-M406 is a subbranch also of G2 (P287), G2a (P15) and finally G2a2b (L30/S126) Haplogroup G-M406 seems most common in Turkey and Greece. Secondary concentrations of G-M406 are found in the northern and eastern Mediterranean, and it is found in very small numbers in more inland areas of Europe, the Middle East, and the southern Caucasus Mountains area.

In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup

Various Y-DNA haplogroups have differing frequencies within each ethnolinguistic group in the Caucasus region.

Genetic studies on Serbs show close affinity to other neighboring South Slavs.

<span class="mw-page-title-main">Y Chromosome Haplotype Reference Database</span>

The Y Chromosome Haplotype Reference Database (YHRD) is an open-access, annotated collection of population samples typed for Y chromosomal sequence variants. Two important objectives are pursued: (1) the generation of reliable frequency estimates for Y-STR haplotypes and Y-SNP haplotypes to be used in the quantitative assessment of matches in forensic and kinship cases and (2) the characterization of male lineages to draw conclusions about the origins and history of human populations. The database is endorsed by the International Society for Forensic Genetics (ISFG). By May 2023 about 350,000 Y chromosomes typed for 9-29 STR loci have been directly submitted by worldwide forensic institutions and universities. In geographic terms, about 53% of the YHRD samples stem from Asia, 21% from Europe, 12% from North America, 10% from Latin America, 3% from Africa, 0.8% from Oceania/Australia and 0.2% from the Arctic. The 1.406 individual sampling projects are described in more than 800 peer-reviewed publications

Population genetics is a scientific discipline which contributes to the examination of the human evolutionary and historical migrations. Particularly useful information is provided by the research of two uniparental markers within our genome, the Y-chromosome (Y-DNA) and mitochondrial DNA (mtDNA), as well as autosomal DNA. The data from Y-DNA and autosomal DNA suggests that the Croats mostly are descendants of the Slavs of the medieval migration period, according to mtDNA have genetic diversity which fits within a broader European maternal genetic landscape, and overall have a uniformity with other South Slavs from the territory of former Yugoslavia.

References

  1. 1 2 "ISOGG 2018 Y-DNA Haplogroup G".
  2. ↑ "Archived copy". Archived from the original on 2015-08-15. Retrieved 2017-09-18.{{cite web}}: CS1 maint: archived copy as title (link)
  3. 1 2 "RootsWeb: GENEALOGY-DNA-L [DNA] A little note about haplogroup G Deep Clade tests". ancestry.com.
  4. ↑ Hammer, M.; et al. (June 2000). "Jewish and Middle Eastern non-Jewish populations share a common pool of Y-chromosome biallelic haplotypes" (PDF). Proc. Natl. Acad. Sci. U.S.A. 97 (12): 6769–74. Bibcode:2000PNAS...97.6769H. doi: 10.1073/pnas.100115997 . PMC   18733 . PMID   10801975.
  5. 1 2 Karafat, T.; et al. (2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–38. doi:10.1101/gr.7172008. PMC   2336805 . PMID   18385274.
  6. ↑ Rootsi, S; et al. (May 2012). "Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus". European Journal of Human Genetics. 20 (8): 1275–1282. doi:10.1038/ejhg.2012.86. PMC   3499744 . PMID   22588667.
  7. ↑ The Y Chromosome Consortium (2002). "A Nomenclature System for the Tree of Human Y-Chromosomal Binary Haplogroups". Genome Research. 12 (2): 339–48. doi:10.1101/gr.217602. PMC   155271 . PMID   11827954.
  8. ↑ Balanovsky, O; Dibirova, K.; Dybo, A.; Mudrak, O.; Frolova, S.; Pocheshkhova, E.; Haber, M.; Platt, D.; et al. (Oct 2011). "Parallel evolution of genes and language in the Caucasus region". Molecular Biology and Evolution. 28 (10): 2905–20. doi:10.1093/molbev/msr126. PMC   3355373 . PMID   21571925.
  9. 1 2 "All About the y Chromosome".
  10. 1 2 "..Project Rosters - Haplogroup G Project". google.com.
  11. ↑ https://sites.google.com/site/haplogroupgproject/project-roster Haplogroup G Project Samples - G2a1/G2a1a
  12. ↑ Sascha Willuweit; Lutz Roewer. "YHRD : Unspported Browser". yhrd.org.
  13. ↑ "Resource dumped by HtmlRendererServlet". runewsweek.ru.
This page is based on this Wikipedia article
Text is available under the CC BY-SA 4.0 license; additional terms may apply.
Images, videos and audio are available under their respective licenses.