FAM120AOS

Last updated
FAM120AOS
Identifiers
Aliases FAM120AOS , C9orf10OS, family with sequence similarity 120A opposite strand
External IDs HomoloGene: 131283; GeneCards: FAM120AOS; OMA:FAM120AOS - orthologs
Orthologs
SpeciesHumanMouse
Entrez

158293

n/a

Ensembl

ENSG00000188938

n/a

UniProt

Q5T036

n/a

RefSeq (mRNA)

NM_198841
NM_001322224

n/a

RefSeq (protein)

NP_001309153
NP_942138

n/a

Location (UCSC) Chr 9: 93.43 – 93.45 Mb n/a
PubMed search [2] n/a
Wikidata
View/Edit Human

FAM120AOS, or family with sequence similarity 120A opposite strand, codes for uncharacterized protein FAM120AOS, which currently has no known function. [3] The gene ontology describes the gene to be protein binding. [4] Overall, it appears that the thyroid and the placenta are the two tissues with the highest expression levels of FAM120AOS across a majority of datasets.

Contents

The microarray-assessed tissue expression pattern of multiple normal tissues for FAM120AOS in humans was found using GDS3834 data. [5] The three tissues in the 90th percentile and higher for FAM120AOS gene expression are as follows: the bladder, epididymis, and thyroid. The thyroid is in the 91st percentile, while the other two are in the 90th percentile. Since high thyroid expression was also seen across the RNA-seq data, [6] [7] [8] [9] it appears that FAM120AOS expression may be important in the thyroid.

Gene

Common aliases

The common aliases for FAM120AOS are C9orf10OS, FLJ31534, LOC158293, and putative FAM120A opposite strand protein. [3]

Locus

There are two genomic locations for the gene, the first of which is chr9:93,431,441-93,453,601(GRCh38/hg38) with a length of 22,161 base pairs (bp), oriented on the minus strand of the chromosome. [10] The second genomic location for the gene is at chr9:96,208,776-96,215,874(GRCh37/hg19) with a length of 7,099 bp, also oriented on the minus strand of the chromosome. [10] The genes found upstream of FAM120AOS on chromosome 9 are FGD3, SUSD, C9orf89, WNK2, C9orf129, and NINJ1. [3] The genes found downstream from FAM120AOS on chromosome 9 are FAM120A and PHF2. [3]

Number of exons

The longest isoform of FAM120AOS in humans contains 3 exons. [4]

Span of gene

The mRNA transcript variant that encodes for human FAM120AOS isoform 1 is 5922 bp long and contains an upstream in-frame stop codon (taa) at 807-809 bp. [11]

Transcripts

There are 12 known isoforms of the human FAM120AOS gene. [4] The longest and most common transcript variant is isoform 1, which is 5922 bp in length. [4] [12] Transcript variants 3-12 are all non-coding RNAs, meaning that they do not code for a protein. [4] The only isoforms that are protein-encoding are isoform 1 and 2 of the human FAM120AOS gene. [4]

Isoform 2 is 5008 bp in length and contains an alternate exon in the 5' UTR, is missing a portion of the 5' coding region, and initiates translation at an alternate start codon, in comparison to isoform 1. [4] [13] The variant also has a shorter and more distinct N-terminus in comparison to isoform 1. [4]

Non-coding RNAS

All of the following variations mentioned are in comparison to isoform 1 of the human FAM120AOS gene.Isoform 3 is 2199 bp and uses an alternate splice site in the first exon. [4] [14] The transcript variants (e.g. isoforms) 6-12 are all candidates for nonsense-mediated mRNA decay (NMD). [4]

Isoform 4 of the gene is 2320 bp and uses an alternate splice site in the first exon and contains an alternate internal exon. [4] [15] Isoform 5 is 6043 bp and contains an alternate internal exon. Isoform 6 is 5272 bp and contains an alternate first exon and an alternate internal exon. [4] [16] Isoform 7 is 5095 bp and contains an alternate first exon. [4] [17] Isoform 8 is 5129 bp and contains an alternate first exon and alternate internal exon. [4] [18] Isoform 9 is 5151 bp and contains an alternate first exon. [4] [19] Isoform 10 is 5354 bp and contains an alternate first exon. [4] [20] Isoform 11 is 5475 bp and contains an alternate first exon and an alternate internal exon. [4] [21] Lastly, isoform 12 5216 is bp and contains an alternate first exon and an alternate internal exon. [4]

Proteins

Isoforms

There are two different isoforms of the human FAM120AOS gene that encode a protein, isoforms 1 and 2. [4] The uncharacterized protein FAM120AOS isoform 1 is 256 amino acids long [22] and the uncharacterized protein FAM120AOS isoform 2 is 74 amino acids long. [23] Uncharacterized protein FAM120AOS isoform 1 is the longer and more abundant isoform found in humans, and contains protein domain Q5T035. [4] [10] The isoform also has a protein interactant, Q5T035-F120S_HUMAN, and CRISPR reagents and clone products of the protein available. [10]

Molecular weight

Uncharacterized protein FAM120AOS isoform 1 (protein isoform 1) in humans has a calculated molecular weight of 27.8 kDa. [4] A theoretical value of 11.93 for the isoelectric point of the protein was determined through the use of ExPASy. [24] The basic isoelectric point indicates that protein isoform 1 is primarily basic. Table 1 shows the isoelectric points and molecular weights for all the different orthologs of the human FAM120AOS protein 1 across Primates and Artiodactyla. [25] The isoelectric point of the protein remains within a pH of 10.05-11.93 across all orthologs, indicating that the protein is primarily basic. However, the molecular weight of the FAM120AOS protein seems to vary greatly between orthologs, ranging from values of 8.1 kDa to 17.9 kDa, with a maximum value of 29.8 kDa. Many of the sequences with a lower molecular weight were found to be composed of fewer amino acids than the sequences with larger molecular weights. These length differences could also be attributed to possible different isoforms of the FAM120AOS protein being analyzed.

Table 1: Isoelectric Point and Molecular Weight of FAM120AOS Protein Across Orthologs
OrganismTaxonomic Group Isoelectric Point Molecular Weight (in kDa)
Homo sapiens Primates 11.9327.9
Pan troglodytes Primates11.9227.7
Pongo abelii Primates11.6927.8
Nomascus leucogenys Primates10.327.9
Hylobates moloch Primates10.068.1
Trachypithecus francoisi Primates11.358.1
Rhinopithecus roxellana Primates11.578.3
Macaca nemestrina Primates11.358.1
Papio anubis Primates10.988.2
Carlito syrichta Primates11.3625.8
Microcebus murinus Primates11.5229.8
Muntiacus muntjak Artiodactyla 11.2117.9

Amino acid composition

The image above shows the two areas of internal repeats identified in uncharacterized protein FAM120AOS isoform 1. The first internal repeat occurs at amino acid positions 41-59 and 88-105. The second internal repeat occurs at amino acid positions 145-153 and 160-168. The bolded amino acids indicate the repeated areas of the sequences. Internal Repeats .png
The image above shows the two areas of internal repeats identified in uncharacterized protein FAM120AOS isoform 1. The first internal repeat occurs at amino acid positions 41-59 and 88–105. The second internal repeat occurs at amino acid positions 145-153 and 160–168. The bolded amino acids indicate the repeated areas of the sequences.

Protein isoform 1 contains two different internal repeats in its amino acid composition, determined through analysis of the protein sequence using Dotlet JS. [26] The first internal repeat occurs at amino acid positions 41-59 and 88–105. [26] The second internal repeat occurs at amino acid positions 145-153 and 160–168. [26] There is an upstream in-frame stop codon (taa) present at amino acid positions 806–808. [4] There is an alternate polyadenylation site present at amino acid positions 2726–2731. [4] The polyadenylation signal used is present from amino acid positions 5889–5893. [4] The amino acid positions from L206-S211, H213, H215, K219-P225, and K227-C233 were found to be conserved across all of the strict orthologs of the human uncharacterized protein FAM120AOS isoform 1. [27] The amino acid G95 was found to be conserved across all Primates and Artiodactyla for which sequences were identified. [27] The human FAM120AOS protein 1 was found to arginine-rich, and glutamic acid and tyrosine-poor. [28]

The image above shows the amino acids that are conserved across human uncharacterized FAM120AOS protein isoform 1 and 8 of its strict orthologs. The purple-colored amino acids are fully conserved, while the pink ones are moderately conserved, and the blue ones are slightly conserved. The highlighted areas represent the exon boundaries of the protein. It appears that a large amount of amino acids coded by exon 2 and 3 of the gene were conserved across the strict orthologs of the protein. FAM120AOS Protein Isoform 1 Strict Ortholog Composition.png
The image above shows the amino acids that are conserved across human uncharacterized FAM120AOS protein isoform 1 and 8 of its strict orthologs. The purple-colored amino acids are fully conserved, while the pink ones are moderately conserved, and the blue ones are slightly conserved. The highlighted areas represent the exon boundaries of the protein. It appears that a large amount of amino acids coded by exon 2 and 3 of the gene were conserved across the strict orthologs of the protein.

Domains and motifs

The uncharacterized protein FAM120AOS isoform 1 in humans contains the protein domain Q5T035. [10]

Two notable motifs found using a eukaryotic linear motif analysis for the human FAM120AOS protein 1 are TRG_RT_diArg_1 and TRG_NLS_MonoExtN_4. [29] The TRG_RT_diArg_1 motif is a di Arginine retention/retrieving signal that is present on membrane proteins, where it serves for ER localization. [29] The TRG_NLS_MonoExtN_4 is a NLS classical nuclear localization signal, which is possessed by many nuclear proteins, indicating that the human FAM120AOS protein 1 is a nuclear protein.

Secondary structure

The secondary structure of the human FAM120AOS protein 1 was predicted by the I-TASSER server and shows 11 alpha helices as follows, in order of position: SER15-TRP18, PRO25-SER27, THR34-TRP40, ALA85-ARG88, LYS111-ALA121, CYS145-ARG155, HIS158-ALA163, LEU169-LYS171, PRO179-ARG198, PRO225-CYS233, and PRO246-PHE252. [30]

Tertiary and quaternary structure

The figure above depicts the iTasser predicted tertiary structure of the human FAM120AOS protein 1. Section A of the figure depicts the predicted tertiary structure, with a possible transmembrane domain highlighted. The purple end sticking out on the bottom left is the start of the coding region (e.g. the methionine), while the red end sticking out towards the left is the end of the strand. The image appears to have 11 alpha helices, represented by the thicker coiled domains. Section B of the figure depicts the predicted tertiary structure of the protein by 35% solvent accessible surface area, which appears white. Section C of the protein shows the secondary structure of the protein, with the alpha helices clearly shown in red. Section D of the protein shows the protein's charge distribution. ITasser results for FAM120A protein 1.png
The figure above depicts the iTasser predicted tertiary structure of the human FAM120AOS protein 1. Section A of the figure depicts the predicted tertiary structure, with a possible transmembrane domain highlighted. The purple end sticking out on the bottom left is the start of the coding region (e.g. the methionine), while the red end sticking out towards the left is the end of the strand. The image appears to have 11 alpha helices, represented by the thicker coiled domains. Section B of the figure depicts the predicted tertiary structure of the protein by 35% solvent accessible surface area, which appears white. Section C of the protein shows the secondary structure of the protein, with the alpha helices clearly shown in red. Section D of the protein shows the protein's charge distribution.

The tertiary structure of the human FAM120AOS protein 1 was predicted by the I-TASSER server with a C-score of -4.00. [30] It appears that the outermost parts of the protein are more solvent accessible, while the inner areas are less solvent accessible. [30] The protein appears to be primarily blue, again indicating that it is a basic structure. [30] The protein also indicated the presence of a peripheral likelihood of 1.48 at amino acid position 132. [31] The NUCDISC results indicated the presence of pat 7 PLKKTKS (4) starting at amino acid position 168. [31]

Gene regulation

Promoter

There are four different promoters for the human FAM120AOS protein 1, which are depicted in the table below. [32] The promoter used for further analysis below (GXP_1829163) is 1665 base pairs long from coordinates 93450944–93452608, with five coding transcripts. [32]

Table 2: Human FAM120A Protein 1 Promoters
PromoterSize (in base pairs)CoordinatesStrandCoding Transcripts
GXP_9004065104093437082-93438121-None (non-coding only)
GXP_228179104093446357-93447396-None (non-coding only)
GXP_1829163166593450944-93452608-5
GXP_2255852148793453115-93454601-2

Transcription factor binding sites

The transcription factors described below were identified on the Human FAM120A protein 1 promoter. [33]

Table 3: Transcription Factors for Human FAM120A Protein 1 Promoter
Code NameFull NameBindingMatrix ScoreStart siteEnd site
AP2FActivator protein 2agcGCCAgacggcac0.862336350
STEMMotif composed of binding sites for pluripotency or stem cell factorscccgtctGCATggcccact0.912255273
ZF20C2H2 Zinc finger transcription factors 20tgcggttACCA0.791447457
E2FFE2F-myc activator/cell cycle regulatortggacacggGATAatgg0.7542945
ZF5FZF5 POZ domain zinc fingerccctgaGCGCcccaggc0.9572844
P53FP53 tumor suppressortgcggttaccaaaggCAAGtcagtg0.954312336
RXRFRXR heterodimer binding sitesttattgacctagGGTCatattatag0.857156180
EBOXE-box binding factorsattatccCGTGtccaga0.901466482
ZF02C2H2 Zinc finger transcription factors 2caaaagcaCCCCcctacacccgc0.93391113
AP1RMAF and AP1 related factorsttggttGCTGagaaatttctagtag0.842356380
PLAGpleomorphic adenoma genetaggGGGGtgcttttgctttcct0.871114136
KLFSKrueppel like transcription factorsagagcttAAAGgattcttc0.976118136
ETSFHuman and murine ETS1 factorsttcagtgaGGAAagcaaaagc0.933196216

Expression pattern

An immunohistochemical staining of the FAM120AOS protein in the human prostate using a FAM120AOS polyclonal antibody indicates the presence of FAM120AOS in the nucleus of glandular cells. [34]

In Homo sapiens (humans), the gene exhibits high levels of expression (in RPKM) in the colon, fat, placenta, prostate, and thyroid, as determined through quantitative transcriptomic analysis (RNA-Seq) with the following respective values: 12.598, 11.727, 10.978, 11.277, and 13.511. [6] During human fetal development, the gene exhibits the highest levels of expression in the intestine at 20 weeks and the lungs at 17 weeks, as determined through the use of circular RNA with the following respective mean RPKM values: 5.066 and 4.365. [7] The sequencing of RNA from 20 human tissues showed the highest levels of FAM120AOS expression in the placenta, prostate, and thyroid, with respective mean RPKM values of 7.057, 3.978, and 4.396. [9] Transcription profiling through high throughput sequencing of both individual and mixtures of 16 human tissues RNA also found high levels of FAM120AOS gene expression in the thyroid, with a mean RPKM of 9.518. [8]

The image above shows the expression pattern for the human FAM120AOS protein in a glioblastoma cell in regards to cyclophilin B (CypB) across 6 samples. In the control group, the expression of FAM120AOS is high, with values in the 83rd percentile. However, in the CypB depletion experimental group, the expression of FAM120AOS is much lower at the 56th, 60th, and 69th percentiles. Therefore, FAM120AOS expression appears to be positively affected by the present of CypB in this glioblastoma multiforme cell line. CypB Depletion Effect on Glioblastoma Multiforme Cell Line.png
The image above shows the expression pattern for the human FAM120AOS protein in a glioblastoma cell in regards to cyclophilin B (CypB) across 6 samples. In the control group, the expression of FAM120AOS is high, with values in the 83rd percentile. However, in the CypB depletion experimental group, the expression of FAM120AOS is much lower at the 56th, 60th, and 69th percentiles. Therefore, FAM120AOS expression appears to be positively affected by the present of CypB in this glioblastoma multiforme cell line.
The image above shows the expression pattern for human FAM120AOS in colorectal cancer line SW480 in genotypes with and without SNAI1 overexpression across 4 samples. In the cancer cell line with SNAI1 overexpression, there is a moderate amount of FAM120AOS expression at the 68th and 69th percentiles. In the control group, expression drops to the 52nd and 56th percentile. Therefore SNAI1 overexpression may be linked to FAM120AOS expression, possibly due to its function as a zinc finger protein. Colorectal Cancer Cell Line SW480 Response to SNAIL Overexpression.png
The image above shows the expression pattern for human FAM120AOS in colorectal cancer line SW480 in genotypes with and without SNAI1 overexpression across 4 samples. In the cancer cell line with SNAI1 overexpression, there is a moderate amount of FAM120AOS expression at the 68th and 69th percentiles. In the control group, expression drops to the 52nd and 56th percentile. Therefore SNAI1 overexpression may be linked to FAM120AOS expression, possibly due to its function as a zinc finger protein.
The image above shows the expression pattern for FAM120AOS in human females and males both with and without type 2 diabetes. For the males and females with normal glucose tolerance, there seems to be a relatively lower percentile of FAM120AOS expression, with one outlier that may be due to other underlying conditions. For males and females with type 2 diabetes, FAM120AOS gene expression is generally expressed at the 90th percentiles, while those with normal glucose tolerance generally have expression at the 10th percentile. Women with type 2 diabetes generally have FAM120AOS expression ranging from the 40th-98th percentile, while women with normal glucose tolerance generally have expression at the 10th percentile. Expression Pattern for FAM120AOS in Type 2 Diabetes.png
The image above shows the expression pattern for FAM120AOS in human females and males both with and without type 2 diabetes. For the males and females with normal glucose tolerance, there seems to be a relatively lower percentile of FAM120AOS expression, with one outlier that may be due to other underlying conditions. For males and females with type 2 diabetes, FAM120AOS gene expression is generally expressed at the 90th percentiles, while those with normal glucose tolerance generally have expression at the 10th percentile. Women with type 2 diabetes generally have FAM120AOS expression ranging from the 40th-98th percentile, while women with normal glucose tolerance generally have expression at the 10th percentile.

Transcript level regulation

The image above shows the presence of 4 stem loops on the 5' UTR of human FAM120AOS protein 1, along with the transcription start site, start codon, upstream (unused) polyadenylation signal and an area of conserved sequence across the human sequence and its strict orthologs. Human FAM120AOS 5' UTR Promoter 1.png
The image above shows the presence of 4 stem loops on the 5' UTR of human FAM120AOS protein 1, along with the transcription start site, start codon, upstream (unused) polyadenylation signal and an area of conserved sequence across the human sequence and its strict orthologs.

There are 4 large stem loops present in the 5' UTR of the human FAM120AOS protein 1. [38] There are 8 miRNA binding sites identified for the human FAM120AOS protein 1. [39]

Table 4: 3' UTR MicroRNA Binding Sites for Human FAM120AOS Protein 1 [39]
miRNA NamemiRNA sequenceTarget ScoreSeed Location
has-miR-4286ACCCCACUCCUGGUACC94475
has-miR-3059-5pUUUCCUCUCUGCCCCAUAGGGUGU88199, 396
has-miR-3152UGUGUUAGAAUAGGGGCAAUAA87173,735
has-miR-4499AAGACUGAGAGGAGGGA83730
has-miR-129-2-3pAAGCCCUUACCCCAAAAAGCAU831022
has-miR-129-1-3pAAGCCCUUACCCCAAAAAGUAU831022
has-miR-6881-3pAUCCUCUUUCGUCCUUCCCACU82199, 395
has-miR-10400-3pCUGGGCUCCCGGACGAGGCGGG81337

Protein level regulation

The K-NN prediction results for the human FAM120AOS protein 1 predicted it to be present in the nucleus of cells. [31] There is a possible transmembrane domain for the protein, present from amino acid position 131–148. [40]

The image above shows the predicted transmembrane domain for the human FAM120AOS protein 1. Predicted Transmembrane Domain for FAM120AOS protein 1.png
The image above shows the predicted transmembrane domain for the human FAM120AOS protein 1.

Homology/evolution

There were no paralogs identified for human FAM120AOS. [4] [10] The most distant homolog for human FAM120AOS detectable is the Microcebus murinus , with a 61.17% sequence identity to the human protein. [41] There was a total of 11 orthologs identified for human FAM120AOS protein 1. [42] No proteins with homologous domains to the human FAM120AOS sequence were identified. [43] FAM120AOS seems to be evolving at a moderate rate, in between that of cytochrome c and fibrinogen alpha. [4]

Table 5: Orthologs of Human FAM120AOS Isoform 1
Genus and speciesCommon NameTaxonomic groupDate of divergence (in MYA)Accession numberSequence length (in aa)Sequence Identity to human proteinSequence similarity to human protein
Homo sapiens Human Primates 0 NP_942138.2 256100.00%100%
Pan troglodytes Chimpanzee Primates6.4 PNI17265.1 25598.44%100%
Pongo abelii Sumtran orangutan Primates15.2 PNJ71424.1 25395.70%100%
Nomascus leucogenys Northern white-cheeked gibbon Primates19.8 XP_030657822.1 7394.12%26%
Hylobates moloch Silvery gibbon Primates19.8 XP_032020454.1 8692.65%26%
Trachypithecus francoisi Francois' leaf monkey Primates28.81 XP_033092605.1 7492.75%26%
Rhinopithecus roxellana Golden snub-nosed monkey Primates28.81 XP_030775307.1 7492.75%26%
Macaca nemestrina Southern pit-tailed macaque Primates28.81 XP_024642522.1 7492.75%26%
Papio anubis Olive baboon Primates28.81 XP_003912044.1 7492.30%26%
Carlito syrichta Philippine tarsier Primates69 XP_021572479.1 23666.82%78%
Microcebus murinus Mouse lemur Primates74.1 XP_020144792 27461.17%76%
Muntiacus muntjak Indian muntjac Artiodactyla 94 KAB0347543.1 16197.18%27%
The time calibrated unrooted phylogenetic tree above shows the phylogeny of the FAM120AOS gene across its strict orthologs. The gene seems to have first appeared between a common ancestor of Homo sapiens (humans) and Microcebus murinus (mouse lemur), which diverged from one another approximately 74.1 million years ago (MYA). Phylogenetic Tree Showing FAM120AOS Evolutionary History.png
The time calibrated unrooted phylogenetic tree above shows the phylogeny of the FAM120AOS gene across its strict orthologs. The gene seems to have first appeared between a common ancestor of Homo sapiens (humans) and Microcebus murinus (mouse lemur), which diverged from one another approximately 74.1 million years ago (MYA).
The approximate date of divergence (from human) for a given species versus corrected divergence for FAM120AOS isoform 1, cytochrome c, and fibrinogen alpha across all identified orthologs. Date of Divergence from Human Species FAM120AOS.png
The approximate date of divergence (from human) for a given species versus corrected divergence for FAM120AOS isoform 1, cytochrome c, and fibrinogen alpha across all identified orthologs.

Function/biochemistry

The function and biochemistry of the human FAM120AOS protein are currently unknown. [4] [10] The single nucleotide polymorphisms (SNPs) did not show any mutations in conserved amino acids, so it is lis likely that two copies of the FAM120AOS gene are necessary for proper function.

Interacting proteins

The FAM120AOS protein is physically associated with the following proteins: MDFI, ELAV1, TRIM25, and APEX1 . [45] [46] [47] [48] [10]

Clinical significance

A missense mutation in the FAM120AOS protein from amino acid threonine at position 248 to isoleucine (T248I) has been linked in one whole-of-exome sequencing study to: coarse facial features, scoliosis, pectus excavatum, skin laxity, hypotonia, GERD, hyperreactive airway disease, [lower-alpha 1] and undescended testicles. [49]

The image above shows the SNPs for human FAM120AOS isoform 1, with stars representing significant missense mutations and triangles representing significant point mutations. SNPs in FAM120AOS Isoform 1.png
The image above shows the SNPs for human FAM120AOS isoform 1, with stars representing significant missense mutations and triangles representing significant point mutations.

Notes

  1. ↑ Elsewhere, Alazami et al. narrow the description of the reported "chronic lung disease" of this participant to "hyperactive airways" instead. [lower-alpha 2] This alternative designation appears in the Supplemental Information of the article. [lower-alpha 3] In the main body of the article (at Table 2, pp. 156–157), the phenotype of the individual possessing the candidate gene mutation includes "chronic lung disease". However, chronic lung—or chronic respiratory diseases—are specified by various authorities as particular diseases or conditions, and do not include "hyperactive airways". According to the Open Targets Platform, [lower-alpha 4] the thoracic societies of the United States (ATS) and Britain (BTS) list chronic lung disease as: fibrosis, bronchiectasis, bullae, emphysema, and nodular or lymphomatous abnormalities. The Australian Institute of Health and Welfare gives asthma, COPD, allergic rhinitis, bronchiectasis, chronic sinusitis, cystic fibrosis, occupational lung diseases, and pulmonary fibrosis as chronic respiratory conditions. [lower-alpha 5]
  3. Alazami AM, Patel N, Shamseldin HE, et al. (January 2015). "Supplemental Information: Document S1 - Figures S1 and S2 and Table S2 of 'Accelerating novel candidate gene discovery in neurogenetic disorders'" (PDF). Cell Reports. 10 (2): 148–161. doi:10.1016/j.celrep.2014.12.015. PMID   25558065. Unpaginated: appears under heading "Family: 12DG0321; Gene: FAM120AOS".
  4. Open Targets Platform. "Evidence for FAM120AOS in chronic lung disease". platform.opentargets.org.
  5. AIHW (28 July 2020). "About Chronic respiratory conditions". Australian Institute of Health and Welfare. Government of Australia. Version: v9.0. Retrieved 9 February 2022.

Related Research Articles

Chromosome 16 open reading frame 95 (C16orf95) is a gene which in humans encodes the protein C16orf95. It has orthologs in mammals, and is expressed at a low level in many tissues. C16orf95 evolves quickly compared to other proteins.

Uncharacterized protein Chromosome 16 Open Reading Frame 71 is a protein in humans, encoded by the C16orf71 gene. The gene is expressed in epithelial tissue of the respiratory system, adipose tissue, and the testes. Predicted associated biological processes of the gene include regulation of the cell cycle, cell proliferation, apoptosis, and cell differentiation in those tissue types. 1357 bp of the gene are antisense to spliced genes ZNF500 and ANKS3, indicating the possibility of regulated alternate expression.

The Family with sequence similarity 149 member B1 is an uncharacterized protein encoded by the human FAM149B1 gene, with one alias KIAA0974. The protein resides in the nucleus of the cell. The predicted secondary structure of the gene contains multiple alpha-helices, with a few beta-sheet structures. The gene is conserved in mammals, birds, reptiles, fish, and some invertebrates. The protein encoded by this gene contains a DUF3719 protein domain, which is conserved across its orthologues. The protein is expressed at slightly below average levels in most human tissue types, with high expression in brain, kidney, and testes tissues, while showing relatively low expression levels in pancreas tissues.

<span class="mw-page-title-main">C6orf62</span> Protein-coding gene in the species Homo sapiens

Chromosome 6 open reading frame 62 (C6orf62), also known as X-trans-activated protein 12 (XTP12), is a gene that encodes a protein of the same name. The encoded protein is predicted to have a subcellular location within the cytosol.

<span class="mw-page-title-main">FAM71E1</span> Mammalian protein found in Homo sapiens

FAM71E1, also known as Family With Sequence Similarity 71 Member E1, is a protein that in humans is encoded by the FAM71E1 gene. It is thought to be ubiquitously expressed at low levels throughout the body, and it is conserved in vertebrates, particularly mammals and some reptiles. The protein is localized to the nucleus and can be exported to the cytoplasm.

C11orf42 is an uncharacterized protein in Homo sapiens that is encoded by the C11orf42 gene. It is also known as chromosome 11 open reading frame 42 and uncharacterized protein C11orf42, with no other aliases. The gene is mostly conserved in mammals, but it has also been found in rodents, reptiles, fish and worms.

<span class="mw-page-title-main">C9orf50</span> Protein-coding gene in the species Homo sapiens

Chromosome 9 open reading frame 50 is a protein that in humans is encoded by the C9orf50 gene. C9orf50 has one other known alias, FLJ35803. In humans the gene coding sequence is 10,051 base pairs long, transcribing an mRNA of 1,624 bases that encodes a 431 amino acid protein.

<span class="mw-page-title-main">C16orf90</span> Protein-coding gene in the species Homo sapiens

C16orf90 or chromosome 16 open reading frame 90 produces uncharacterized protein C16orf90 in homo sapiens. C16orf90's protein has four predicted alpha-helix domains and is mildly expressed in the testes and lowly expressed throughout the body. While the function of C16orf90 is not yet well understood by the scientific community, it has suspected involvement in the biological stress response and apoptosis based on expression data from microarrays and post-translational modification data.

<span class="mw-page-title-main">C7orf50</span> Mammalian protein found in Homo sapiens

C7orf50 is a gene in humans that encodes a protein known as C7orf50. This gene is ubiquitously expressed in the kidneys, brain, fat, prostate, spleen, among 22 other tissues and demonstrates low tissue specificity. C7orf50 is conserved in chimpanzees, Rhesus monkeys, dogs, cows, mice, rats, and chickens, along with 307 other organisms from mammals to fungi. This protein is predicted to be involved with the import of ribosomal proteins into the nucleus to be assembled into ribosomal subunits as a part of rRNA processing. Additionally, this gene is predicted to be a microRNA (miRNA) protein coding host gene, meaning that it may contain miRNA genes in its introns and/or exons.

<span class="mw-page-title-main">C17orf78</span> Mammalian protein found in Homo sapiens

Uncharacterized protein C17orf78 is a protein encoded by the C17orf78 gene in humans. The name denotes the location of the parent gene, being at the 78th open reading frame, on the 17th human chromosome. The protein is highly expressed in the small intestine, especially the duodenum. The function of C17orf78 is not well defined.

TMEM275 is a protein that in humans is encoded by the TMEM275 gene. TMEM275 has two, highly-conserved, helical trans-membrane regions. It is predicted to reside within the plasma membrane or the endoplasmic reticulum's membrane.

C2orf74, also known as LOC339804, is a protein encoding gene located on the short arm of chromosome 2 near position 15 (2p15). Isoform 1 of the gene is 19,713 base pairs long. C2orf74 has orthologs in 135 different species, including primarily placental mammals and some marsupials.

<span class="mw-page-title-main">C9orf85</span> Protein-coding gene in the species Homo sapiens

Chromosome 9 open reading frame 85, commonly known as C9orf85, is a protein in Homo sapiens encoded by the C9orf85 gene. The gene is located at 9q21.13. When spliced, four different isoforms are formed. C9orf85 has a predicted molecular weight of 20.17 kdal. Isoelectric point was found to be 9.54. The function of the gene has not yet been confirmed, however it has been found to show high levels of expression in cells of high differentiation.

<span class="mw-page-title-main">FAM214B</span> Protein-coding gene in the species Homo sapiens

The FAM214B, also known as protein family with sequence similarity 214, B (FAM214B) is a protein that, in humans, is encoded by the FAM214B gene located on the human chromosome 9. The protein has 538 amino acids. The gene contain 9 exon. There has been studies that there are low expression of this gene in patients with major depression disorder. In most organisms such as mammals, amphibians, reptiles, and birds, there are high levels of gene expression in the bone marrow and blood. For humans in fetal development, FAM214B is mostly expressed in the brains and bone marrow.

<span class="mw-page-title-main">FAM166C</span>

Family with Sequence Similarity 166, member C (FAM166C), is a protein encoded by the FAM166C gene. The protein FAM166C is localized in the nucleus. It has a calculated molecular weight of 23.29 kDa. It also contains DUF2475, a protein of unknown function from amino acid 19–85. The FAM166C protein is nominally expressed in the testis, stomach, and thyroid.

<span class="mw-page-title-main">TEKTIP1</span> Gene

TEKTIP1, also known as tektin-bundle interacting protein 1, is a protein that in humans is encoded by the TEKTIP1 gene.

<span class="mw-page-title-main">THAP3</span> Protein in Humans

THAP domain-containing protein 3 (THAP3) is a protein that, in Homo sapiens (humans), is encoded by the THAP3 gene. The THAP3 protein is as known as MGC33488, LOC90326, and THAP domain-containing, apoptosis associated protein 3. This protein contains the Thanatos-associated protein (THAP) domain and a host-cell factor 1C binding motif. These domains allow THAP3 to influence a variety of processes, including transcription and neuronal development. THAP3 is ubiquitously expressed in H. sapiens, though expression is highest in the kidneys.

<span class="mw-page-title-main">C13orf46</span> C13of46 Gene and Protein

Chromosome 13 Open Reading Frame 46 is a protein which in humans is encoded by the C13orf46 gene. In humans, C13orf46 is ubiquitously expressed at low levels in tissues, including the lungs, stomach, prostate, spleen, and thymus. This gene encodes eight alternatively spliced mRNA transcript, which produce five different protein isoforms.

<span class="mw-page-title-main">SCRN3</span> Protein-coding gene in the species Homo sapiens

Secernin-3 (SCRN3) is a protein that is encoded by the human SCRN3 gene. SCRN3 belongs to the peptidase C69 family and the secernin subfamily. As a part of this family, the protein is predicted to enable cysteine-type exopeptidase activity and dipeptidase activity, as well as be involved in proteolysis. It is ubiquitously expressed in the brain, thyroid, and 25 other tissues. Additionally, SCRN3 is conserved in a variety of species, including mammals, birds, fish, amphibians, and invertebrates. SCRN3 is predicted to be an integral component of the cytoplasm.

<span class="mw-page-title-main">LRRC74A</span> Protein-coding gene

Leucine-rich repeat-containing protein 74A (LRRC74A), is a protein encoded by the LRRC74A gene. The protein LRRC74A is localized in the cytoplasm. It has a calculated molecular weight of approximately 55 kDa. The LRRC74A protein is nominally expressed in the testis, salivary gland, and pancreas.

References

  1. 1 2 3 GRCh38: Ensembl release 89: ENSG00000188938 – Ensembl, May 2017
  2. ↑ "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  3. 1 2 3 4 "AceView: Gene:FAM120AOS, a comprehensive annotation of human, mouse and worm genes with mRNAs or ESTsAceView". www.ncbi.nlm.nih.gov. Retrieved 2020-10-04.
  4. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 "FAM120AOS family with sequence similarity 120A opposite strand [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-10-04.
  5. ↑ "GDS3834 / 7875". www.ncbi.nlm.nih.gov. Retrieved 2020-12-18.
  6. 1 2 Fagerberg L, Hallström BM, Oksvold P, Kampf C, Djureinovic D, Odeberg J, et al. (February 2014). "Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics". Molecular & Cellular Proteomics. 13 (2): 397–406. doi: 10.1074/mcp.M113.035600 . PMC   3916642 . PMID   24309898.
  7. 1 2 Szabo L, Morey R, Palpant NJ, Wang PL, Afari N, Jiang C, et al. (June 2015). "Statistically based splicing detection reveals neural enrichment and tissue-specific induction of circular RNA during human fetal development". Genome Biology. 16 (1): 126. doi: 10.1186/s13059-015-0690-5 . PMC   4506483 . PMID   26076956.
  8. 1 2 "Illumina bodyMap2 transcriptome (ID 204271) - BioProject - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-18.
  9. 1 2 Duff MO, Olson S, Wei X, Garrett SC, Osman A, Bolisetty M, et al. (May 2015). "Genome-wide identification of zero nucleotide recursive splicing in Drosophila". Nature. 521 (7552): 376–379. Bibcode:2015Natur.521..376D. doi:10.1038/nature14475. PMC   4529404 . PMID   25970244.
  10. 1 2 3 4 5 6 7 8 "FAM120AOS Gene - F120S Protein - F120S Antibody". www.genecards.org. Retrieved 2020-10-04.
  11. ↑ NCBI (2020-10-12). "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 1, mRNA - NCBI Reference Sequence: NM_198841.4". GenBank Nucleotide.
  12. ↑ "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 1, mRNA". 2020-10-12.{{cite journal}}: Cite journal requires |journal= (help)
  13. ↑ "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 2, mRNA". 2020-12-12.{{cite journal}}: Cite journal requires |journal= (help)
  14. ↑ "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 3, non-coding RNA". 2020-07-23.{{cite journal}}: Cite journal requires |journal= (help)
  15. ↑ "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 4, non-coding RNA". 2020-07-23.{{cite journal}}: Cite journal requires |journal= (help)
  16. ↑ "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 6, non-coding RNA". 2020-07-25.{{cite journal}}: Cite journal requires |journal= (help)
  17. ↑ "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 7, non-coding RNA". 2020-07-25.{{cite journal}}: Cite journal requires |journal= (help)
  18. ↑ "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 8, non-coding RNA". 2020-07-25.{{cite journal}}: Cite journal requires |journal= (help)
  19. ↑ "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 9, non-coding RNA". 2020-07-25.{{cite journal}}: Cite journal requires |journal= (help)
  20. ↑ "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 10, non-coding RNA". 2020-07-25.{{cite journal}}: Cite journal requires |journal= (help)
  21. ↑ "Homo sapiens family with sequence similarity 120A opposite strand (FAM120AOS), transcript variant 11, non-coding RNA". 2020-07-25.{{cite journal}}: Cite journal requires |journal= (help)
  22. ↑ "Uncharacterized protein FAM120AOS isoform 1 [Homo sapiens] - Protein - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-18.
  23. ↑ "Uncharacterized protein FAM120AOS isoform 2 [Homo sapiens] - Protein - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-18.
  24. ↑ Gasteiger E, Gattiker A, Hoogland C, Ivanyi I, Appel RD, Bairoch A (July 2003). "ExPASy: The proteomics server for in-depth protein knowledge and analysis". Nucleic Acids Research. 31 (13): 3784–8. doi:10.1093/nar/gkg563. PMC   168970 . PMID   12824418.
  25. ↑ "Compute pI/MW - SIB Swiss Institute of Bioinformatics". www.Expasy.org. Retrieved 2020-12-19.
  26. 1 2 3 "Dotlet JS". dotlet.vital-it.ch. Retrieved 2020-12-18.
  27. 1 2 3 "Clustal Omega < Multiple Sequence Alignment < EMBL-EBI". www.ebi.ac.uk. Retrieved 2020-12-19.
  28. ↑ "EBI Tools". www.ebi.ac.uk. Retrieved 2020-12-19.
  29. 1 2 "ELM". elm.eu.org. Retrieved 2020-12-19.
  30. 1 2 3 4 "I-TASSER server for protein structure and function prediction". zhanglab.ccmb.med.umich.edu. Retrieved 2020-12-19.
  31. 1 2 3 "PSORT II Prediction". psort.hgc.jp. Retrieved 2020-12-19.
  32. 1 2 "Gene2Promoter". www.genomatix.de. Retrieved 2020-12-19.
  33. ↑ "MatInspector: Search for transcription factor binding sites". www.genomatix.de. Archived from the original on 2002-08-12. Retrieved 2020-12-19.
  34. ↑ "FAM120AOS Antibodies". ThermoFisher Scientific.
  35. ↑ "GEO Profiles - 104737339 - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
  36. ↑ "GEO Profiles - 100460041 - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
  37. 1 2 3 "104737339 - GEO Profiles - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
  38. ↑ "RNAfold web server". rna.tbi.univie.ac.at. Retrieved 2020-12-19.
  39. 1 2 "miRDB - Custom Prediction". mirdb.org. Retrieved 2020-12-19.
  40. ↑ "EBI Tools: Job not available". www.ebi.ac.uk. Retrieved 2020-12-19.
  41. ↑ "LOW QUALITY PROTEIN: uncharacterized protein FAM120AOS [Microcebus mur - Protein - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
  42. ↑ "BLAST: Basic Local Alignment Search Tool". blast.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
  43. ↑ "Human BLAT Search". genome.ucsc.edu. Retrieved 2020-12-19.
  44. ↑ "TimeTree:The Timescale of Life". timetree.org. Retrieved 2020-10-25.
  45. ↑ "MDFI - MyoD family inhibitor, isoform CRA_a - Homo sapiens (Human) - MDFI gene & protein". www.uniprot.org. Retrieved 2020-12-19.
  46. ↑ "ELAVL1 - ELAV-like protein 1 - Homo sapiens (Human) - ELAVL1 gene & protein". www.uniprot.org. Retrieved 2020-12-19.
  47. ↑ "TRIM25 Gene - TRI25 Protein -TRI25 Antibody". www.genecards.org. Retrieved 2020-12-19.
  48. ↑ "FAM120AOS (RP11-165J3.1) Result Summary - BioGRID". thebiogrid.org. Retrieved 2020-12-19.
  49. ↑ Alazami AM, Patel N, Shamseldin HE, Anazi S, Al-Dosari MS, Alzahrani F, et al. (January 2015). "Accelerating novel candidate gene discovery in neurogenetic disorders via whole-exome sequencing of prescreened multiplex consanguineous families". Cell Reports. 10 (2): 148–61. doi: 10.1016/j.celrep.2014.12.015 . PMID   25558065.
  50. ↑ "SNP linked to Gene (geneID:158293) Via Contig Annotation". www.ncbi.nlm.nih.gov. Retrieved 2020-12-19.
This page is based on this Wikipedia article
Text is available under the CC BY-SA 4.0 license; additional terms may apply.
Images, videos and audio are available under their respective licenses.