Human identical sequence

Last updated

The human identical sequence (HIS) is a sequence of RNA elements, 24-27 nucleotides in length, that coronavirus genomes share with the human genome. [1] In pathogenic progression, HIS acts as a NamiRNA (nuclear activating miRNA) through the NamiRNA-enhancer network to activate neighboring host genes. [2] [3] The first HIS elements was identified in the SARS-CoV-2 genome, which has five HIS elements; other human coronaviruses have one to five. [1] It has been suggested that these sequences can be more generally termed "host identical sequences" since similar correlations have been found between the genome of SARS-CoV-2 and multiple potential hosts (bats, pangolins, ferrets, and cats). [1]

Contents

SARS-CoV-2

namelengthsequencelocation in virus genomelocation in human genomeneighboring genesnote
HIS-SARS2-126UGUCUAUGCUAAUGGAGGUAAAGGCU7570–7595 in ORF1a Chr3: 124017420-124017395 KALRN
HIS-SARS2-224UAUAACACAUATAAAAAUACGUGU12494–12517 in ORF1a Chr3: 176597319-176597342
HIS-SARS2-324UUAUAUGCCUUAUUUCUUUACUUU6766–6789 in ORF1a Chr5: 28949255-28949232
HIS-SARS2-427AGGAGAAUGACAAAAAAAAAAAAAAAA29860–29886 in 3' UTR Chr18: 73670168-73670142 FBXO15, TIMM21  [ uk ], CYB5A same as HIS-SARS1-2
HIS-SARS2-524UUGUUGCUGCUAUUUUCUAUUUAA8610–8633 in ORF1a ChrX: 99693480-99693457

SARS-CoV-1

namelengthsequencelocation in virus genomelocation in human genomeneighboring genesnote
HIS-SARS-125UAACAUGCUUAGGAUAAUGGCCUCU15251–15275 in ORF1b Chr4: 172887105–172887129
Chr8: 122356667-122356690		 HAS2, ZHX2
HIS-SARS-227AGGAGAAUGACAAAAAAAAAAAAAAAA29717–29743 in 3' UTR Chr18: 73670168-73670142same as HIS-SARS2-4

MERS-CoV

namelengthsequencelocation in virus genomelocation in human genomeneighboring genesnote
HIS-MERS-124UUCCAUUUGCACAGAGUAUCUUUU24364–24387 in S ChrX: 25635779-25635802

HCoV-HKU1

namelengthsequencelocation in virus genomelocation in human genomeneighboring genesnote
HIS-HKU1-124UUAGAAUUGUUCAAAUGUUAUCUG18656-18679 chr1:106816197-106816220
HIS-HKU1-224UUUUCUAAGAAAGAUUGGUAUGAU14044-14067 chr1:226438633-226438656
chr4:151100495-151100518
chr5:79284823-79284846
chr5:111192947-111192970
chr7:94695722-94695745
chr7:98386489-98386512
chr15:59768424-59768447
chr22:30137367-30137390
HIS-HKU1-324AUUUGACUUUAAAUCUUCAUACUA26693-26716 chr4:11718458-11718481
HIS-HKU1-424GAUUGGUUGUAUUUUCAUUUUUAU23527-23550 chr4:33759646-33759669
HIS-HKU1-524UAGAUACUGUUAUUUUUAAAAAUA19844-19867 chrX:81711130-81711153

HCoV-NL63

namelengthsequencelocation in virus genomelocation in human genomeneighboring genesnote
HIS-NL63-124UUAUGAUUUUGGUGAUUUUGUUGU13044-13067 chr1:215311768-215311791
HIS-NL63-224GGUGUUUUUGUUGAUGAUGUUGUU14920-14943 chr4:28254452-28254475
HIS-NL63-324AUAGGCUUAAAUGCUUCUGUUACU20754-20777 chr6:30469931-30469954
HIS-NL63-424AAGUAAUUGUAUUAAGAUGUUAUC12124-12147 chr7:19853545-19853568
HIS-NL63-524AACUUUUAUGAUUUUGGUGAUUUU13039-13062 chr9:1525276-1525299

HCoV-OC43

namelengthsequencelocation in virus genomelocation in human genomeneighboring genesnote
HIS-OC43-124UACAGCUCUUUGUAAAUCUGGUAG22827-22850 chr8:122471006-122471029HAS2, ZHX2
HIS-OC43-224UUGUAUGAGUGAUUUUAUGAGUGA24509-24532 chr13:30510223-30510246

HCoV-229E

namelengthsequencelocation in virus genomelocation in human genomeneighboring genesnote
HIS-229E-124AAUAUUUUAACAGUACCACGUUAU19817-19840 chr8:42865576-42865599
HIS-229E-224ACUUUGUAUUGUGUCCUCCUGGAA13139-13162 chr11:112451251-112451274

References

  1. 1 2 3 Li, W; Yang, S; Xu, P; Zhang, D; Tong, Y; Chen, L; Jia, B; Li, A; Lian, C; Ru, D; Zhang, B; Liu, M; Chen, C; Fu, W; Yuan, S; Gu, C; Wang, L; Li, W; Liang, Y; Yang, Z; Ren, X; Wang, S; Zhang, X; Song, Y; Xie, Y; Lu, H; Xu, J; Wang, H; Yu, W (February 2022). "SARS-CoV-2 RNA elements share human sequence identity and upregulate hyaluronan via NamiRNA-enhancer network". EBioMedicine. 76 103861. doi:10.1016/j.ebiom.2022.103861. PMC   8811534 . PMID   35124429.
  2. ↑ Yang, S; Ling, Y; Zhao, F; Li, W; Song, Z; Wang, L; Li, Q; Liu, M; Tong, Y; Chen, L; Ru, D; Zhang, T; Zhou, K; Zhang, B; Xu, P; Yang, Z; Li, W; Song, Y; Xu, J; Zhu, T; Shan, F; Yu, W; Lu, H (18 March 2022). "Hymecromone: a clinical prescription hyaluronan inhibitor for efficiently blocking COVID-19 progression". Signal Transduction and Targeted Therapy. 7 (1): 91. doi:10.1038/s41392-022-00952-w. PMC   8931182 . PMID   35304437.
  3. ↑ Xiao M, Li J, Li W, Wang Y, Wu F, Xi Y, Zhang L, Ding C, Luo H, Li Y, Peng L, Zhao L, Peng S, Xiao Y, Dong S, Cao J, Yu W (October 2017). "MicroRNAs activate gene transcription epigenetically as an enhancer trigger". RNA Biology. 14 (10): 1326–1334. doi:10.1080/15476286.2015.1112487. PMC   5711461 . PMID   26853707.


This page is based on this Wikipedia article
Text is available under the CC BY-SA 4.0 license; additional terms may apply.
Images, videos and audio are available under their respective licenses.