The human identical sequence (HIS) is a sequence of RNA elements, 24-27 nucleotides in length, that coronavirus genomes share with the human genome. [1] In pathogenic progression, HIS acts as a NamiRNA (nuclear activating miRNA) through the NamiRNA-enhancer network to activate neighboring host genes. [2] [3] The first HIS elements was identified in the SARS-CoV-2 genome, which has five HIS elements; other human coronaviruses have one to five. [1] It has been suggested that these sequences can be more generally termed "host identical sequences" since similar correlations have been found between the genome of SARS-CoV-2 and multiple potential hosts (bats, pangolins, ferrets, and cats). [1]
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note | 
|---|---|---|---|---|---|---|
| HIS-SARS2-1 | 26 | UGUCUAUGCUAAUGGAGGUAAAGGCU | 7570–7595 in ORF1a | Chr3: 124017420-124017395 | KALRN | |
| HIS-SARS2-2 | 24 | UAUAACACAUATAAAAAUACGUGU | 12494–12517 in ORF1a | Chr3: 176597319-176597342 | ||
| HIS-SARS2-3 | 24 | UUAUAUGCCUUAUUUCUUUACUUU | 6766–6789 in ORF1a | Chr5: 28949255-28949232 | ||
| HIS-SARS2-4 | 27 | AGGAGAAUGACAAAAAAAAAAAAAAAA | 29860–29886 in 3' UTR | Chr18: 73670168-73670142 | FBXO15, TIMM21 , CYB5A | same as HIS-SARS1-2 | 
| HIS-SARS2-5 | 24 | UUGUUGCUGCUAUUUUCUAUUUAA | 8610–8633 in ORF1a | ChrX: 99693480-99693457 | 
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note | 
|---|---|---|---|---|---|---|
| HIS-SARS-1 | 25 | UAACAUGCUUAGGAUAAUGGCCUCU | 15251–15275 in ORF1b |  Chr4: 172887105–172887129 Chr8: 122356667-122356690  | HAS2, ZHX2 | |
| HIS-SARS-2 | 27 | AGGAGAAUGACAAAAAAAAAAAAAAAA | 29717–29743 in 3' UTR | Chr18: 73670168-73670142 | same as HIS-SARS2-4 | 
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note | 
|---|---|---|---|---|---|---|
| HIS-MERS-1 | 24 | UUCCAUUUGCACAGAGUAUCUUUU | 24364–24387 in S | ChrX: 25635779-25635802 | 
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note | 
|---|---|---|---|---|---|---|
| HIS-HKU1-1 | 24 | UUAGAAUUGUUCAAAUGUUAUCUG | 18656-18679 | chr1:106816197-106816220 | ||
| HIS-HKU1-2 | 24 | UUUUCUAAGAAAGAUUGGUAUGAU | 14044-14067 |  chr1:226438633-226438656 chr4:151100495-151100518 chr5:79284823-79284846 chr5:111192947-111192970 chr7:94695722-94695745 chr7:98386489-98386512 chr15:59768424-59768447 chr22:30137367-30137390  | ||
| HIS-HKU1-3 | 24 | AUUUGACUUUAAAUCUUCAUACUA | 26693-26716 | chr4:11718458-11718481 | ||
| HIS-HKU1-4 | 24 | GAUUGGUUGUAUUUUCAUUUUUAU | 23527-23550 | chr4:33759646-33759669 | ||
| HIS-HKU1-5 | 24 | UAGAUACUGUUAUUUUUAAAAAUA | 19844-19867 | chrX:81711130-81711153 | 
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note | 
|---|---|---|---|---|---|---|
| HIS-NL63-1 | 24 | UUAUGAUUUUGGUGAUUUUGUUGU | 13044-13067 | chr1:215311768-215311791 | ||
| HIS-NL63-2 | 24 | GGUGUUUUUGUUGAUGAUGUUGUU | 14920-14943 | chr4:28254452-28254475 | ||
| HIS-NL63-3 | 24 | AUAGGCUUAAAUGCUUCUGUUACU | 20754-20777 | chr6:30469931-30469954 | ||
| HIS-NL63-4 | 24 | AAGUAAUUGUAUUAAGAUGUUAUC | 12124-12147 | chr7:19853545-19853568 | ||
| HIS-NL63-5 | 24 | AACUUUUAUGAUUUUGGUGAUUUU | 13039-13062 | chr9:1525276-1525299 | 
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note | 
|---|---|---|---|---|---|---|
| HIS-OC43-1 | 24 | UACAGCUCUUUGUAAAUCUGGUAG | 22827-22850 | chr8:122471006-122471029 | HAS2, ZHX2 | |
| HIS-OC43-2 | 24 | UUGUAUGAGUGAUUUUAUGAGUGA | 24509-24532 | chr13:30510223-30510246 | 
| name | length | sequence | location in virus genome | location in human genome | neighboring genes | note | 
|---|---|---|---|---|---|---|
| HIS-229E-1 | 24 | AAUAUUUUAACAGUACCACGUUAU | 19817-19840 | chr8:42865576-42865599 | ||
| HIS-229E-2 | 24 | ACUUUGUAUUGUGUCCUCCUGGAA | 13139-13162 | chr11:112451251-112451274 |