See also
Y-DNA R-M207 subclades
Y-DNA backbone tree
| |||
Footnotes
| |||
| Haplogroup R2 | |
|---|---|
| Possible time of origin | 27,000 BP [1] |
| Possible place of origin | South Asia or Central Asia [1] |
| Ancestor | Haplogroup R |
| Descendants | R2a (M124); R2b (FGC21706) |
| Defining mutations | M479 |
Haplogroup R2, or R-M479, is a Y-chromosome haplogroup characterized by genetic marker M479. It is one of two primary descendants of Haplogroup R (R-M207), the other being R1 (R-M173).
R-M479 has been concentrated geographically in South Asia and Central Asia since prehistory. It appears to reach its highest levels among the Burusho people in North Pakistan. [2] However, it also appears to be present at low levels in the Caucasus, Iran, Anatolia and Europe.[ citation needed ]
It has two primary branches: R2a (M124) and R2b (R-FGC21706)
Source: ISOGG 2017. [1]
Most research has tested only for the presence of R-M479 (R2) and R-M124 (R2a) – or SNPs downstream from M124 like P249, P267, L266, PAGES00004, and L381 SNPs). Because the other primary branch, R2b (R-FGC21706) was discovered later than R2a, it has often not been tested for. Hence most results are best described as R2(xR2a).
In addition, relatively little research has been done within South Asia, which is known to have the greatest concentration of R2. (Hence the figures cited in the table right may not be indicative of true frequencies, i.e. Pakistan is the only South Asian country that has been included.)
In 2013, R2(xR2a) was found in 5 out of 19 males from the Burusho minority of North Pakistan. [2]
Haplogroup R2a (R-M124) is characterized by SNPs M124, F820/Page4, L381, P249, [1] and is mainly found in South Asia, with lower frequencies in Central Asia and the Caucasus.[ citation needed ] R-M124 is also found in multiple Jewish populations: Iraqi Jews, Persian Jews, Mountain Jews, and Ashkenazi Jews. [3]
It is found especially in the Indian subcontinent. [4]
| M479 |
| |||||||||
| Common Name Marker | M479 |
|---|---|
| YCC Haplogroup | R-M479 |
| Nucleotide change | C to T |
| Amplicon size (bp) reference sequence | 323 |
| Polymorphism position from 5' end | 107 |
| Restriction enzyme variant | HphI |
| RefSNP ID | - |
| Y-position | 19294055 |
| Primer forward 5'-3' | gatactttatcaggcttacttc |
| Primer reverse 5'-3' | aaccaaatctctcagaatcg |
| |||
Footnotes
| |||
A haplotype is a group of alleles in an organism that are inherited together from a single parent, and a haplogroup is a group of similar haplotypes that share a common ancestor with a single-nucleotide polymorphism mutation. More specifically, a haplotype is a combination of alleles at different chromosomal regions that are closely linked and that tend to be inherited together. As a haplogroup consists of similar haplotypes, it is usually possible to predict a haplogroup from haplotypes. Haplogroups pertain to a single line of descent. As such, membership of a haplogroup, by any individual, relies on a relatively small proportion of the genetic material possessed by that individual.
Haplogroup G (M201) is a human Y-chromosome haplogroup. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK.
In human genetics, Haplogroup J-M172 or J2 is a Y-chromosome haplogroup which is a subclade (branch) of haplogroup J-M304. Haplogroup J-M172 is common in modern populations in Western Asia, Central Asia, South Asia, Southern Europe, Northwestern Iran and North Africa. It is thought that J-M172 may have originated between the Caucasus, Anatolia and/or Western Iran.
Haplogroup H (Y-DNA), also known as H-L901/M2939, is a Y-chromosome haplogroup.
Haplogroup L-M20 is a human Y-DNA haplogroup, which is defined by SNPs M11, M20, M61 and M185. As a secondary descendant of haplogroup K and a primary branch of haplogroup LT, haplogroup L currently has the alternative phylogenetic name of K1a, and is a sibling of haplogroup T.
Haplogroup Q or Q-M242 is a Y-chromosome DNA haplogroup. It has one primary subclade, Haplogroup Q1 (L232/S432), which includes numerous subclades that have been sampled and identified in males among modern populations.
Haplogroup R1, or R-M173, is a Y-chromosome DNA haplogroup. A primary subclade of Haplogroup R (R-M207), it is defined by the SNP M173. The other primary subclade of Haplogroup R is Haplogroup R2 (R-M479).
In human genetics, a human Y-chromosome DNA haplogroup is a haplogroup defined by mutations in the non-recombining portions of DNA from the male-specific Y chromosome. Many people within a haplogroup share similar numbers of short tandem repeats (STRs) and types of mutations called single-nucleotide polymorphisms (SNPs).
Haplogroup R, or R-M207, is a Y-chromosome DNA haplogroup. It is both numerous and widespread amongst modern populations.
Haplogroup R2a, or haplogroup R-M124, is a Y-chromosome haplogroup characterized by genetic markers M124, P249, P267, L266, and is mainly found in South Asia as well as in Central Asia, Caucasus, Southwest Asia, and the Arab countries with low frequencies.
The Burusho, or Brusho, also known as the Botraj, are an ethnolinguistic group indigenous to the Yasin, Hunza, Nagar, and other valleys of Gilgit–Baltistan in northern Pakistan, with a tiny minority of around 350 Burusho people residing in Jammu and Kashmir, India. Their language, Burushaski, has been classified as a language isolate.
Paragroup is a term used in population genetics to describe lineages within a haplogroup that are not defined by any additional unique markers.
Haplogroup IJ (M429/P125) is a human Y-chromosome DNA haplogroup, an immediate descendant of Haplogroup IJK. IJK is a branch of Haplogroup HIJK.
Haplogroup G-M377 is a Y-chromosome haplogroup and is defined by the presence of the M377 mutation. It is a branch of Haplogroup G2b-M3115, which in turn is defined by the presence of the M3115 mutation. It was found among Pashtuns, who are classified as Iranic and on much lower scale among all major Jewish groups, Palestinians, Lebanese and Syrians(See also page covering Jews with Haplogroup G )
Haplogroup R1a, or haplogroup R-M420, is a human Y-chromosome DNA haplogroup which is distributed in a large region in Eurasia, extending from Scandinavia and Central Europe to Central Asia, southern Siberia and South Asia.
Haplogroup R1b (R-M343), previously known as Hg1 and Eu18, is a human Y-chromosome haplogroup.
In human genetics, Haplogroup R-M167 (R1b1a1a2a1a2a1b1a1) is a Y-chromosome haplogroup which is a subdivision of Haplogroup R-DF27 and the wider haplogroup R-M269 defined by the presence of the marker M167.
Haplogroup R-L295 also known as R2a1 is a Y-chromosome haplogroup characterized by genetic marker L295, which has been found in South Asia, Anatolia, Arabian Peninsula, Europe and Central Asia.
HaplogroupGHIJK, defined by the SNPs M3658, F1329, PF2622, and YSC0001299, is a common Y-chromosome haplogroup. This macrohaplogroup and its subclades contain the vast majority of the world's existing male population.
Haplogroup P1, also known as P-M45 and K2b2a, is a Y-chromosome DNA haplogroup in human genetics. Defined by the SNPs M45 and PF5962, P1 is a primary branch (subclade) of P.
