Haplogroup R2

Last updated

Haplogroup R2
Haplogroup R (Y-DNA).png
Possible time of origin27,000 BP [1]
Possible place of origin South Asia  or  Central Asia [1]
Ancestor Haplogroup R
Descendants R2a (M124);
R2b (FGC21706)
Defining mutationsM479

Haplogroup R2, or R-M479, is a Y-chromosome haplogroup characterised by genetic marker M479. It is one of two primary descendants of Haplogroup R (R-M207), the other being R1 (R-M173).

Contents

R-M479, especially its downstream R2a (R-M124), has been concentrated geographically in South Asia, Central Asia and parts of the Middle East since prehistory. [2] R2 (excluding R2a) appears to reach its highest levels among the Burusho people in North Pakistan. [3]

R2 has much lower rates of sampling compared to its R1 counterpart [4] with 399 branches downstream off R-M479, opposed to 46,529 for R-M173.

It has two primary branches: R2a (M124) and R2b (R-FGC21706)

Structure


Source: ISOGG 2017. [1]

Geographical distribution

Most research has tested only for the presence of R-M479 (R2) and R-M124 (R2a) – or SNPs downstream from M124 like P249, P267, L266, PAGES00004, and L381 SNPs). Because the other primary branch, R2b (R-FGC21706) was discovered later than R2a, it has often not been tested for. Hence most results are best described as R2(xR2a).

In addition, relatively little research has been done within South Asia, which is known to have the greatest concentration of R2. (Hence the figures cited in the table right may not be indicative of true frequencies, i.e. Pakistan is the only South Asian country that has been included.)

In 2013, R2(xR2a) was found in 5 out of 19 males from the Burusho minority of North Pakistan. [3]

R2a (R-M124)

Haplogroup R2a (R-M124) is characterised by SNPs M124, F820/Page4, L381, P249, [1] and is mainly found in South Asia, with lower frequencies in Central Asia, Middle East and the Caucasus. [2] R-M124 is also found in multiple Jewish populations: Iraqi Jews, Persian Jews, Mountain Jews, and Ashkenazi Jews. [5]

R2b (R-FGC21706/ R-FGC50231)

It is found especially in the Indian subcontinent. On FTDNA the greatest frequency of R-FGC50231 testers originate from Pakistan, with 2% of testers being classified as R-FGC50231, additionally other prominent nations include, India, Afghanistan and Tajikistan. [6] [7]

Phylogenetic tree

M479

R2*

M124

 R2a

 FGC21706

  R2b

Description of the SNP M479

Common Name MarkerM479
YCC HaplogroupR-M479
Nucleotide changeC to T
Amplicon size (bp) reference sequence323
Polymorphism position from 5' end107
Restriction enzyme variantHphI
RefSNP ID-
Y-position19294055
Primer forward 5'-3'gatactttatcaggcttacttc
Primer reverse 5'-3'aaccaaatctctcagaatcg

Notes

  1. 1 2 3 4 ISOGG, 2017, Y-DNA Haplogroup R and its Subclades – 2017 (17 June 2017).
  2. 1 2 Manoukian, Jean-Grégoire (1 December 2006). "A Synthesis of Haplogroup R2" (PDF). ysearch.org. Archived from the original (PDF) on 27 September 2007.
  3. 1 2 Cristofaro, Julie Di; Pennarun, Erwan; Mazières, Stéphane; Myres, Natalie M.; Lin, Alice A.; Temori, Shah Aga; Metspalu, Mait; Metspalu, Ene; Witzel, Michael; King, Roy J.; Underhill, Peter A.; Villems, Richard; Chiaroni, Jacques (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLOS ONE. 8 (10) e76748. Bibcode:2013PLoSO...876748D. doi: 10.1371/journal.pone.0076748 . PMC   3799995 . PMID   24204668.
  4. ↑ "FamilyTreeDNA - Genetic Testing for Ancestry, Family History & Genealogy". FamilyTreeDNA . Retrieved 3 January 2026.
  5. ↑ Kevin Alan Brook, The Jews of Khazaria, Third Edition, Rowman & Littlefield, 2018, p. 185.
  6. ↑ "R-FGC50227 YTree". YFull. Retrieved 15 February 2024.
  7. ↑ "Welcome to FamilyTreeDNA Discover". FamilyTreeDNA. Retrieved 3 January 2026.

See also

Y-DNA R-M207 subclades

Y-DNA backbone tree


This page is based on this Wikipedia article
Text is available under the CC BY-SA 4.0 license; additional terms may apply.
Images, videos and audio are available under their respective licenses.