Eteplirsen

Last updated
Eteplirsen
Eteplirsen.svg
Clinical data
Trade names Exondys 51
Other namesAVI-4658
License data
Routes of
administration 		Intravenous infusion
Drug class Antisense oligonucleotide
ATC code
Legal status
Legal status
Identifiers
  • (P-deoxy-P-(dimethylamino))(2',3'-dideoxy-2',3'-imino-2',3'-seco)(2'a→5')(C-m5U-C-C-A-A-C-A-m5U-C-A-A-G-G-A-A-G-A-m5U-G-G-C-A-m5U-m5U-m5U-C-m5U-A-G),5'-(P-(4-((2-(2-(2-hydroxyethoxy)ethoxy)ethoxy)carbonyl)-1-piperazinyl)-N,N-dimethylphosphonamidate) RNA
CAS Number
DrugBank
ChemSpider
UNII
KEGG
ChEMBL
Chemical and physical data
Formula C364H569N177O122P30
Molar mass 10305.886 g·mol−1
  • Cc1cn(c(=O)[nH]c1=O)[C@H]2CN(C[C@H](O2)COP(=O)(N3C[C@H](O[C@H](C3)n4ccc(nc4=O)N)COP(=O)(N5CCN(CC5)C(=O)OCCOCCOCCO)N(C)C)N(C)C)P(=O)(N(C)C)OC[C@@H]6CN(C[C@@H](O6)n7ccc(nc7=O)N)P(=O)(N(C)C)OC[C@@H]8CN(C[C@@H](O8)n9ccc(nc9=O)N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1ncnc2N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1ncnc2N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1ccc(nc1=O)N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1ncnc2N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cc(c(=O)[nH]c1=O)C)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1ccc(nc1=O)N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1ncnc2N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1ncnc2N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1nc([nH]c2=O)N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1nc([nH]c2=O)N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1ncnc2N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1ncnc2N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1nc([nH]c2=O)N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1ncnc2N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cc(c(=O)[nH]c1=O)C)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1nc([nH]c2=O)N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1nc([nH]c2=O)N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1ccc(nc1=O)N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1ncnc2N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cc(c(=O)[nH]c1=O)C)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cc(c(=O)[nH]c1=O)C)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cc(c(=O)[nH]c1=O)C)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1ccc(nc1=O)N)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cc(c(=O)[nH]c1=O)C)P(=O)(N(C)C)OC[C@@H]1CN(C[C@@H](O1)n1cnc2c1ncnc2N)P(=O)(N(C)C)OC[C@@H]1CNC[C@@H](O1)n1cnc2c1nc([nH]c2=O)N
  • InChI=1S/C364H569N177O122P30/c1-215-94-519(357(563)444-331(215)543)267-137-490(108-230(642-267)167-612-667(574,454(14)15)483-101-223(635-260(130-483)512-75-68-252(365)425-350(512)556)160-605-664(571,451(8)9)482-84-82-481(83-85-482)364(570)603-91-90-602-89-88-601-87-86-542)673(580,460(26)27)607-162-225-103-484(131-261(637-225)513-76-69-253(366)426-351(513)557)666(573,453(12)13)606-161-224-102-486(133-263(636-224)515-78-71-255(368)428-353(515)559)669(576,456(18)19)621-176-240-118-502(149-279(652-240)532-204-414-294-310(377)394-194-404-320(294)532)684(591,471(48)49)625-179-242-120-498(145-275(654-242)528-200-410-290-306(373)390-190-400-316(290)528)680(587,467(40)41)610-165-228-106-488(135-265(640-228)517-80-73-257(370)430-355(517)561)671(578,458(22)23)619-174-238-116-499(146-276(650-238)529-201-411-291-307(374)391-191-401-317(291)529)681(588,468(42)43)616-171-234-112-492(139-269(646-234)521-96-217(3)333(545)446-359(521)565)675(582,462(30)31)609-164-227-105-487(134-264(639-227)516-79-72-256(369)429-354(516)560)670(577,457(20)21)622-177-241-119-503(150-280(653-241)533-205-415-295-311(378)395-195-405-321(295)533)685(592,472(50)51)626-180-243-122-506(153-282(655-243)535-207-417-297-313(380)397-197-407-323(297)535)688(595,475(56)57)631-186-249-128-511(158-288(661-249)541-214-424-304-330(541)437-349(387)443-343(304)555)693(600,480(66)67)633-188-251-129-509(156-287(663-251)540-213-423-303-329(540)436-348(386)442-342(303)554)691(598,478(62)63)629-183-246-124-504(151-281(658-246)534-206-416-296-312(379)396-196-406-322(296)534)686(593,473(52)53)627-181-244-123-505(152-283(656-244)536-208-418-298-314(381)398-198-408-324(298)536)687(594,474(54)55)630-185-248-127-508(155-286(660-248)539-212-422-302-328(539)435-347(385)441-341(302)553)690(597,477(60)61)628-182-245-121-501(148-278(657-245)531-203-413-293-309(376)393-193-403-319(293)531)683(590,470(46)47)618-173-236-114-496(143-273(648-236)525-100-221(7)337(549)450-363(525)569)679(586,466(38)39)624-184-247-125-510(157-285(659-247)538-211-421-301-327(538)434-346(384)440-340(301)552)692(599,479(64)65)632-187-250-126-507(154-284(662-250)537-210-420-300-326(537)433-345(383)439-339(300)551)689(596,476(58)59)611-166-229-107-489(136-266(641-229)518-81-74-258(371)431-356(518)562)672(579,459(24)25)620-175-239-117-500(147-277(651-239)530-202-412-292-308(375)392-192-402-318(292)530)682(589,469(44)45)617-172-235-113-494(141-271(647-235)523-98-219(5)335(547)448-361(523)567)677(584,464(34)35)615-170-233-111-493(140-270(645-233)522-97-218(4)334(546)447-360(522)566)676(583,463(32)33)614-169-232-110-491(138-268(644-232)520-95-216(2)332(544)445-358(520)564)674(581,461(28)29)608-163-226-104-485(132-262(638-226)514-77-70-254(367)427-352(514)558)668(575,455(16)17)613-168-231-109-495(142-272(643-231)524-99-220(6)336(548)449-362(524)568)678(585,465(36)37)623-178-237-115-497(144-274(649-237)527-199-409-289-305(372)389-189-399-315(289)527)665(572,452(10)11)604-159-222-92-388-93-259(634-222)526-209-419-299-325(526)432-344(382)438-338(299)550/h68-81,94-100,189-214,222-251,259-288,388,542H,82-93,101-188H2,1-67H3,(H2,365,425,556)(H2,366,426,557)(H2,367,427,558)(H2,368,428,559)(H2,369,429,560)(H2,370,430,561)(H2,371,431,562)(H2,372,389,399)(H2,373,390,400)(H2,374,391,401)(H2,375,392,402)(H2,376,393,403)(H2,377,394,404)(H2,378,395,405)(H2,379,396,406)(H2,380,397,407)(H2,381,398,408)(H,444,543,563)(H,445,544,564)(H,446,545,565)(H,447,546,566)(H,448,547,567)(H,449,548,568)(H,450,549,569)(H3,382,432,438,550)(H3,383,433,439,551)(H3,384,434,440,552)(H3,385,435,441,553)(H3,386,436,442,554)(H3,387,437,443,555)/t222-,223-,224-,225-,226-,227-,228-,229-,230-,231-,232-,233-,234-,235-,236-,237-,238-,239-,240-,241-,242-,243-,244-,245-,246-,247-,248-,249-,250-,251-,259+,260+,261+,262+,263+,264+,265+,266+,267+,268+,269+,270+,271+,272+,273+,274+,275+,276+,277+,278+,279+,280+,281+,282+,283+,284+,285+,286+,287+,288+,664?,665?,666?,667?,668?,669?,670?,671?,672?,673?,674?,675?,676?,677?,678?,679?,680?,681?,682?,683?,684?,685?,686?,687?,688?,689?

Eteplirsen (brand name Exondys 51) is a medication to treat, but not cure, some types of Duchenne muscular dystrophy (DMD), caused by a specific mutation. Eteplirsen only targets specific mutations and can be used to treat about 14% of DMD cases. [1] [2] Eteplirsen is a form of antisense therapy.

Contents

Eteplirsen was developed by Steve Wilton, Sue Fletcher and colleagues at the University of Western Australia and commercialized by Sarepta Therapeutics. [3] After a controversial debate surrounding the drug's efficacy, during which two FDA review panel members resigned in protest, eteplirsen received accelerated approval from the US Food and Drug administration in late 2016. [4] [5] The Committee for Medicinal Products for Human Use (CHMP) of the European Medicines Agency (EMA) refused to authorize the use of eteplirsen. [6]

Adverse effects

The following adverse events were observed in at least 10% of people who received eteplirsen in trials: vomiting, contusion, excoriation, arthralgia, rash, catheter site pain, and upper respiratory tract infection. [7]

Mechanism of action

Duchenne muscular dystrophy is caused when a mutation in the DMD gene changes the DMD mRNA so that it no longer codes for functional dystrophin protein, usually due to a nonsense mutation that introduces a premature stop codon into the mRNA.[ citation needed ] If an exon with an appropriate number of bases lies near the mutation, by removing the defective exon the downstream reading frame can be corrected and production of partially functional dystrophin can be restored.[ citation needed ] This is the general strategy used for designing exon-skipping oligos for DMD; as there are 79 exons transcribed in the longest splice form of the dystrophin transcript, many different oligos are needed to address the range of mutations present in the population of people with DMD.[ citation needed ]

Eteplirsen is a morpholino antisense oligomer which triggers excision of exon 51 during pre-mRNA splicing of the dystrophin RNA transcript. Skipping exon 51 changes the downstream reading frame of dystrophin; [8] giving eteplirsen to a healthy person would result in production of dystrophin mRNA which would not code for functional dystrophin protein but, for DMD patients with particular nonsense mutations, giving eteplirsen can restore the reading frame of the dystrophin mRNA and result in production of functional (although modified by having an internal deletion consisting of both the patient's original defect, as well as the therapeutically skipped exon) dystrophin. [9] Eteplirsen is given by intravenous infusion for systemic treatment of DMD.

Exon skipping is induced by eteplirsen, a charge-neutral, phosphorodiamidate morpholino oligomer (PMO) that selectively binds to exon 51 of dystrophin pre-mRNA, restoring the phase of the reading frame and enabling production of functional, but internally edited, dystrophin. [10] The uncharged nature of the PMO helps make it resistant to biological degradation. [11] This modified dystrophin protein produced by eteplirsen may cause a less severe form of dystrophinopathy, much like Becker muscular dystrophy. Eteplirsen's proposed mechanism of action is to bind to dystrophin pre-mRNA and alter the exon splicing of the RNA so that more almost full-length dystrophin is made. By increasing the quantity of an abnormal, but potentially functional, dystrophin protein, the objective is to slow or prevent the progression of DMD. [10] [12]

Nature and sequence of oligo and target

Eteplirsen is a morpholino phosphorodiamidate antisense oligomer.

CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488 [10] ),
30-mer,
20% G,
43% CG,
Predicted Tm: 88.9 °C at 10 μM oligo.

Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG

DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG

Pharmacokinetics

Following single or multiple intravenous infusions, the majority of drug elimination occurred within 24 hours of intravenous administration. Elimination half-life of eteplirsen was 3 to 4 hours. [7]

History

New Drug Applications (NDA) for eteplirsen and a similar drug drisapersen were filed with the US Food and Drug Administration (FDA) in August 2015. [13] The Prescription Drug User Fee Act (PDUFA) goal dates for these were December 27, 2015 for drisapersen and February 26, 2016, for eteplirsen. Following FDA rejection of drisapersen, the agency announced a three-month time extension for its review of eteplirsen. The FDA panel decision was controversial because the FDA staff and the panel used a stricter standard of evidence than Sarepta and patient groups used. The FDA panel said that it was required by law to apply the standard of "substantial evidence" of effectiveness. This required randomized, controlled trials showing effectiveness of a meaningful clinical outcome, such as the ability to function in daily life. Sarepta and patient groups wanted to use the standard of historical controls, personal testimonies, and the presence of altered dystrophin in the body. On April 25, 2016, the Advisory Committee Panel voted against approval;. [14] However, in June 2016, FDA requested for additional data from Sarepta to confirm findings of dystrophin production by eteplirsen. Janet Woodcock, director of the FDA's Center for Drug Evaluation and Research, overruled the panel, and FDA Commissioner Robert Califf deferred to her decision. Eterplirsen received accelerated approval on September 19, 2016. [15]

The European Medicines Agency reviewed the molecule in 2018, and refused to approve it. [6] [16]

Following the approval of eteplirsen, two other drugs of a similar kind, golodirsen and viltolarsen received provisional approval from the FDA for the treatment of people with a confirmed mutation of the dystrophin gene that is amenable to exon 53 skipping [17] [18] as well as casimersen for exon 45 skipping. [19]

Society and culture

Economics

The US list price of eteplirsen is US$300,000 per year of treatmentcitation needed. The Institute for Clinical and Economic Review has found the drug not cost effective at the list price when the cost of one Quality-adjusted life year (QALY) was equal to US$150,000. [20]

Related Research Articles

<span class="mw-page-title-main">Dystrophin</span> Rod-shaped cytoplasmic protein

Dystrophin is a rod-shaped cytoplasmic protein, and a vital part of a protein complex that connects the cytoskeleton of a muscle fiber to the surrounding extracellular matrix through the cell membrane. This complex is variously known as the costamere or the dystrophin-associated protein complex (DAPC). Many muscle proteins, such as α-dystrobrevin, syncoilin, synemin, sarcoglycan, dystroglycan, and sarcospan, colocalize with dystrophin at the costamere. It has a molecular weight of 427 kDa

<span class="mw-page-title-main">Duchenne muscular dystrophy</span> Type of muscular dystrophy

Duchenne muscular dystrophy (DMD) is a severe type of muscular dystrophy predominantly affecting boys. The onset of muscle weakness typically begins around age four, with rapid progression. Initially, muscle loss occurs in the thighs and pelvis, extending to the arms, which can lead to difficulties in standing up. By the age of 12, most individuals with Duchenne muscular dystrophy are unable to walk. Affected muscles may appear larger due to an increase in fat content, and scoliosis is common. Some individuals may experience intellectual disability, and females carrying a single copy of the mutated gene may show mild symptoms.

<span class="mw-page-title-main">Becker muscular dystrophy</span> Genetic muscle disorder

Becker muscular dystrophy (BMD) is an X-linked recessive inherited disorder characterized by slowly progressing muscle weakness of the legs and pelvis. It is a type of dystrophinopathy. The cause is mutations and deletions in any of the 79 exons encoding the large dystrophin protein, essential for maintaining the muscle fiber's cell membrane integrity. Becker muscular dystrophy is related to Duchenne muscular dystrophy in that both result from a mutation in the dystrophin gene, however the hallmark of Becker is milder in-frame deletions. and hence has a milder course, with patients maintaining ambulation till 50–60 years if detected early.

<span class="mw-page-title-main">Morpholino</span> Chemical compound

A Morpholino, also known as a Morpholino oligomer and as a phosphorodiamidate Morpholino oligomer (PMO), is a type of oligomer molecule used in molecular biology to modify gene expression. Its molecular structure contains DNA bases attached to a backbone of methylenemorpholine rings linked through phosphorodiamidate groups. Morpholinos block access of other molecules to small specific sequences of the base-pairing surfaces of ribonucleic acid (RNA). Morpholinos are used as research tools for reverse genetics by knocking down gene function.

Antisense therapy is a form of treatment that uses antisense oligonucleotides (ASOs) to target messenger RNA (mRNA). ASOs are capable of altering mRNA expression through a variety of mechanisms, including ribonuclease H mediated decay of the pre-mRNA, direct steric blockage, and exon content modulation through splicing site binding on pre-mRNA. Several ASOs have been approved in the United States, the European Union, and elsewhere.

Sarepta Therapeutics, Inc. is a medical research and drug development company with corporate offices and research facilities in Cambridge, Massachusetts, United States. Incorporated in 1980 as AntiVirals, shortly before going public the company changed its name from AntiVirals to AVI BioPharma soon with stock symbol AVII and in July 2012 changed name from AVI BioPharma to Sarepta Therapeutics and SRPT respectively. As of 2023, the company has four approved drugs.

The dystrophin-associated protein complex, also known as the dystrophin-associated glycoprotein complex is a multiprotein complex that includes dystrophin and the dystrophin-associated proteins. It is one of the two protein complexes that make up the costamere in striated muscle cells. The other complex is the integrin-vinculin-talin complex.

<span class="mw-page-title-main">Ataluren</span> Duchenne muscular dystrophy medication

Ataluren, sold under the brand name Translarna, is a medication for the treatment of Duchenne muscular dystrophy. It was designed by PTC Therapeutics.

In molecular biology, exon skipping is a form of RNA splicing used to cause cells to “skip” over faulty or misaligned sections (exons) of genetic code, leading to a truncated but still functional protein despite the genetic mutation.

Prosensa was a biotechnology company engaged in the discovery, development and commercialization of RNA-modulating therapeutics. The company targets genetic disorders with a large unmet medical need, with a primary focus on neuromuscular and neurodegenerative disorders such as Duchenne muscular dystrophy (DMD), myotonic dystrophy, and Huntington's disease. Prosensa was acquired by BioMarin

Drisapersen is an experimental drug that was under development by BioMarin, after acquisition of Prosensa, for the treatment of Duchenne muscular dystrophy. The drug is a 2'-O-methyl phosphorothioate oligonucleotide that alters the splicing of the dystrophin RNA transcript, eliminating exon 51 from the mature dystrophin mRNA.

<span class="mw-page-title-main">Marathon Pharmaceuticals</span> Former U.S. rare disease drug company

Marathon Pharmaceuticals LLC was a privately held biopharmaceuticals company focused on drugs for people with rare diseases. The Illinois-based company developed and manufactured therapeutics and brought them to market. It employed 100 people in four global locations. In 2017, PTC Therapeutics acquired rights to Marathon Pharmaceuticals' drug Emflaza (deflazacort) for $140 million after criticism about their plan to sell the drug at a list price of $89,000 per year to sufferers despite the fact that the same drug was available in Canada and the UK for around $1,000 per year.

<span class="mw-page-title-main">Ezutromid</span> Chemical compound

Ezutromid is an orally administered small molecule utrophin modulator involved in a Phase 2 clinical trial produced by Summit Therapeutics for the treatment of Duchenne muscular dystrophy (DMD). DMD is a fatal x-linked recessive disease affecting approximately 1 in 5000 males and is a designated orphan disease by the FDA and European Medicines Agency. Approximately 1/3 of the children obtain DMD as a result of spontaneous mutation in the dystrophin gene and have no family history of the disease. Dystrophin is a vital component of mature muscle function, and therefore DMD patients have multifarious forms of defunct or deficient dystrophin proteins that all manifest symptomatically as muscle necrosis and eventually organ failure. Ezutromid is theorized to maintain utrophin, a protein functionally and structurally similar to dystrophin that precedes and is replaced by dystrophin during development. Utrophin and dystrophin are reciprocally expressed, and are found in different locations in a mature muscle cell. However, in dystrophin-deficient patients, utrophin was found to be upregulated and is theorized to replace dystrophin in order to maintain muscle fibers. Ezutromid is projected to have the potential to treat all patients suffering with DMD as it maintains the production of utrophin to counteract the lack of dystrophin to retard muscle degeneration. Both the FDA and European Medicines Agency has given ezutromid an orphan drug designation. The FDA Office of Orphan Products and Development offers an Orphan Drug Designation program (ODD) that allows drugs aimed to treat diseases that affect less than 200,000 people in the U.S. monetary incentives such as a period of market exclusivity, tax incentives, and expedited approval processes.

Golodirsen, sold under the brand name Vyondys 53, is a medication used for the treatment of Duchenne muscular dystrophy (DMD). It is an antisense oligonucleotide drug of phosphorodiamidate morpholino oligomer (PMO) chemistry.

Viltolarsen, sold under the brand name Viltepso, is a medication used for the treatment of Duchenne muscular dystrophy (DMD). Viltolarsen is a Morpholino antisense oligonucleotide.

<span class="mw-page-title-main">Cure Rare Disease</span>

Cure Rare Disease is a non-profit biotechnology company based in Boston, Massachusetts that is working to create novel therapeutics using gene therapy, gene editing and antisense oligonucleotides to treat people impacted by rare and ultra-rare genetic neuromuscular conditions.

Toshifumi (Toshi) Yokota is a medical scientist and professor of medical genetics at the University of Alberta, where he also holds the titles of the Friends of Garrett Cumming Research & Muscular Dystrophy Canada Endowed Research Chair and the Henri M. Toupin Chair in Neurological Science. He is best known for his pioneering research in antisense therapy for muscular dystrophy that led to the development of an FDA-approved drug viltolarsen. His research interests include precision medicine for muscular dystrophy and genetic diseases. He has co-edited three books published in the Methods in Molecular Biology series from Humana Press, Springer-Nature, and has published more than 100 refereed papers and patents. He is a fellow of the Canadian Academy of Health Sciences, a member of the editorial boards for the International Journal of Molecular Sciences, Genes, Frontiers in Genome Editing, Frontiers in Physiology, and Nucleic Acid Therapeutics, a member of the Medical and Scientific Advisory Committee of Muscular Dystrophy Canada, and a co-founder of the Canadian Neuromuscular Network (CAN-NMD).

Casimersen, sold under the brand name Amondys 45, is an antisense oligonucleotide medication used for the treatment of Duchenne muscular dystrophy (DMD) in people who have a confirmed mutation of the dystrophin gene that is amenable to exon 45 skipping. It is an antisense oligonucleotide of phosphorodiamidate morpholino oligomer (PMO). Duchenne muscular dystrophy is a rare disease that primarily affects boys. It is caused by low levels of a muscle protein called dystrophin. The lack of dystrophin causes progressive muscle weakness and premature death.

Delandistrogene moxeparvovec, sold under the brand name Elevidys, is a recombinant gene therapy used for the treatment of Duchenne muscular dystrophy. It is designed to deliver into the body a gene that leads to production of Elevidys micro-dystrophin that contains selected domains of the dystrophin protein present in normal muscle cells. It is an adeno-associated virus vector-based gene therapy that is given by injection into a vein.

Stephen Donald Wilton, also known as Steve Wilton, is an Australian molecular biologist and academic, serving as the Foundation Professor of Molecular Therapy at Murdoch University and adjunct professor at the University of Western Australia (UWA). He also fulfills dual roles as a Director at the Perron Institute for Neurological and Translational Science and deputy director at Murdoch's Centre for Molecular Medicine and Innovative Therapeutics (CMMIT).

References

  1. ↑ Scoto M, Finkel R, Mercuri E, Muntoni F (August 2018). "Genetic therapies for inherited neuromuscular disorders". The Lancet. Child & Adolescent Health. 2 (8): 600–609. doi:10.1016/S2352-4642(18)30140-8. PMID   30119719. S2CID   52032568.
  2. ↑ Lim KR, Maruyama R, Yokota T (2017). "Eteplirsen in the treatment of Duchenne muscular dystrophy". Drug Design, Development and Therapy. 11: 533–545. doi: 10.2147/DDDT.S97635 . PMC   5338848 . PMID   28280301. Eteplirsen is applicable for approximately 14% of patients with DMDmutations
  3. ↑ "Perron and UWA to reap $70 million windfall". 3 June 2021. Retrieved 16 November 2021.
  4. ↑ "FDA grants accelerated approval to first drug for Duchenne muscular dystrophy". Press Announcements. U.S. Food & Drug Administration. September 19, 2016. Retrieved September 19, 2016.
  5. ↑ "Railroading at the FDA". Nature Biotechnology. 34 (11): 1078. November 2016. doi: 10.1038/nbt.3733 . PMID   27824847.
  6. 1 2 "Exondys EPAR". European Medicines Agency (EMA). 17 September 2018. Retrieved 13 August 2020.
  7. 1 2 "Eteplirsen - prescribing information" (PDF). FDA. September 2016.
  8. ↑ Anthony K, Feng L, Arechavala-Gomeza V, Guglieri M, Straub V, Bushby K, et al. (October 2012). "Exon skipping quantification by quantitative reverse-transcription polymerase chain reaction in Duchenne muscular dystrophy patients treated with the antisense oligomer eteplirsen". Human Gene Therapy Methods. 23 (5): 336–45. doi:10.1089/hgtb.2012.117. PMID   23075107.
  9. ↑ Moulton HM, Moulton JD (December 2010). "Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy". Biochimica et Biophysica Acta (BBA) - Biomembranes. 1798 (12): 2296–303. doi: 10.1016/j.bbamem.2010.02.012 . PMID   20170628.
  10. 1 2 3 "Eteplirsen" (PDF). FDA Briefing Document. 25 April 2016.
  11. ↑ Kole R, Leppert BJ (July 2012). "Targeting mRNA splicing as a potential treatment for Duchenne muscular dystrophy". Discovery Medicine. 14 (74): 59–69. PMID   22846203.
  12. ↑ Mendell JR, Rodino-Klapac LR, Sahenk Z, Roush K, Bird L, Lowes LP, et al. (November 2013). "Eteplirsen for the treatment of Duchenne muscular dystrophy". Annals of Neurology. 74 (5): 637–47. doi: 10.1002/ana.23982 . PMID   23907995. S2CID   24359589.
  13. ↑ "FDA Accepts Sarepta's NDA for Eteplirsen". Rare Disease Report. Archived from the original on 2015-08-28. Retrieved 2015-08-28.
  14. ↑ Pollack, Andrew (2016-04-25). "Advisers to F.D.A. Vote Against Duchenne Muscular Dystrophy Drug". The New York Times.
  15. ↑ Column: To appease a patient lobby, did the FDA approve a $300,000 drug that doesn't work? Michael Hiltzik, Los Angeles Times, October 28, 2016
  16. ↑ "Going Its Own Way, European Regulators Reject Sarepta's Exondys 51 for DMD". BioSpace. Retrieved 2019-12-14.
  17. ↑ Anwar S, Yokota T (August 2020). "Golodirsen for Duchenne muscular dystrophy". Drugs of Today. 56 (8): 491–504. doi:10.1358/dot.2020.56.8.3159186. PMID   33025945. S2CID   222183389.
  18. ↑ Dhillon S (Jul 2020). "Viltolarsen: first approval". Drugs. 80 (10): 1027–1031. doi:10.1007/s40265-020-01339-3. PMID   32519222. S2CID   219542850.
  19. ↑ "FDA Approves Targeted Treatment for Rare Duchenne Muscular Dystrophy Mutation". Food and Drug Administration . 25 February 2021.
  20. ↑ "ICER sees current DMD therapies as too pricey, but notes data limitations". BioPharma Dive. Retrieved 2019-12-14.
This page is based on this Wikipedia article
Text is available under the CC BY-SA 4.0 license; additional terms may apply.
Images, videos and audio are available under their respective licenses.