Listeria monocytogenes non-coding RNA

Last updated
Listeria snRNA rli22
RF01457.png
Predicted secondary structure of Listeria snRNA rli22
Identifiers
Symbolrli22
Rfam RF01457
Other data
RNA type gene, snRNA
Domain Listeria
PDB structures PDBe

Listeria monocytogenes is a gram positive bacterium and causes many food-borne infections such as Listeriosis. This bacteria is ubiquitous in the environment where it can act as either a saprophyte when free living within the environment or as a pathogen when entering a host organism. Many non-coding RNAs have been identified within the bacteria genome where several of these have been classified as novel non-coding RNAs and may contribute to pathogenesis. [1]

Contents

Tiling arrays and mutagenesis identified many non-coding RNAs within the L. monocytogenes genome and the location of these non-coding RNAs within the bacterial genome was confirmed by RACE (rapid amplification of cDNA ends) analysis. These studies showed that the expression of many non-coding RNAs was dependent on the environment and that several of these non-coding RNAs act as cis-regulatory elements. Comparisons between previously characterized non-coding RNAs and those present in the L. monocyotogenes genome identified 50 novel non-coding RNAs in L. monocyotogenes. An additional comparative study between the pathogenic L. monocytogenes strain and the non pathogenic L. innocua strain identified several non-coding RNAs that are only present within L. monocytogenes which suggests that these ncRNAs may have a role in pathogenesis. [2] The tables below summarizes the location, flanking genes and also the characteristics of the novel small non-coding RNAs identified and the previously characterized non-coding RNAs present in L. monocytogenes

Novel Non-coding RNAs

IDStartStopSize5′ flanking genesense of the gene on the genomea3′ flanking geneCharacteristicRfam
rli223199732107110lmo0028->->->lmo0029sRNA
rli2317217117226897lmo0172<-->sRNA Antisense to lmo0172 transposase Homolog of rli25 and rli35.
rli24271029271186157lmo0256->->->lmo0257sRNA
rli25357618357516102lmo0330-><-sRNA Antisense to lmo0330: transposase. Homolog of rli23 and rli35
rli26388707388520187lmo0360-><-<-lmo0361sRNA
rli2743483143492998lmo0411<--><-lmo0412sRNA
rli28507394507206188lmo0470-><-->lmo0471sRNA Homolog of rli50
rli29507643507450193lmo0470-><-->lmo0471sRNA Antisense to the 5'UTR of lmo0471
rli30540785540670115lmo0506-><-sRNA Antisense to lmo0506
rli31597812597926114lmo0558<-->->lmo0559Required for lysozyme resistance and pathogenesis. [3] Structure characterized as two long hairpins. Interacts with the RNA binding global regulator SpoVG. [4]
rli32600750600604147lmo0560<-<-<-lmo0561sRNA
rli33708326708860534lmo0671->->->lmo0672sRNA
rli3480303180294883lmo0777-><-->lmo0778sRNA
rli35855495855393102lmo0828-><-sRNA Antisense to lmo0828: transposase. Homolog of rli23 and rli25
rli3685952785944483nifJ-><-<-fbpsRNA
rli37907576907832256lmo0866->->->lmo0867ORF ORF of 58aa. RBS region: TGATACGGGAGTGTGGTGCTAGTTATG
rli3811525491152917369lmo1115<-->->lmo1116sRNA role in virulence
rli3911798071179993187lmo1149->-><-lmo1150sRNA Annotated as a cobalamin riboswitch in Rfam
rli4012758101275547264lmo1251-><-<-lmo1252ORF ORF of 64 aa. RBS region: AGTGAGGCGTCCTTATG
rli4112772071276713495lmo1252<-<-->lmo1253Two ORFs ORF of 45 aa. RBS region: AGAGGAGGTATTTTCTATG ORF of 35 aa. RBS region:AAGGAGGAAAACAAATTG
rli4213996171399447171lmo1374-><-->lmo1375sRNA
rli4318616301861377253inlC<-<-<-rplSORF ORF of 35aa. RBS region: AGAGTGAGGTGTAATATG
rli4420390872039375289lmo1964<--><-lmo1965ORF ORF of 28aa. RBS region: GGAAAGGATAACCCATG
rli452154775215485277lmo2074->-><-lmo2075sRNA Antisense to rli46
rli4621550582154765294lmo2074-><-<-lmo2075sRNA Antisense to rli45
rli4722260242226532508lmo2141->-><-lmo2142sRNA
rli4823614232361274149lmo2271<-<-->lmo2272sRNA
rli4926601792660364185lmo2579->-><-lmo2580sRNA
rli5027832742783098176lmo2709-><-<-lmo2710sRNA Homolog of rli28
rli51207589207709120hly->->->mpl5′-UTR-derived Increased in intestinal lumen
rli5255242155232794lmo0517<-<-<-lmo05185′-UTR-derived Putative riboswitch.
rli53955829956001172lmo0918->->->lmo09195′-UTR-derived Putative riboswitch.
rli5410785841079111527lmo1051<-->->pdhA5′-UTR-derived Putative riboswitch.
rli5511981071198389282lmo1170->->->pduQ5′-UTR-derived Putative riboswitch.
rli561199859119995899pduQ->->->lmo11725′-UTR-derived Putative riboswitch.
rli57?1216658?lmo1190->->->cbiA3′-UTR-derived Annotated as a cobalamin riboswitch in Rfam lmo1190-rli57 transcript levelncreasedinintestinal lumen
rli58?1639974?rpsD-><-<-lmo1597
rli5917025531702373180lmo1652<-<-<-lmo16535′-UTR-derived
rli6020541242054308184lmo1982<-->->ilvD5′-UTR-derived Putative riboswitch.
rli6122753632275258106lmo2187<-<-<-lmo21885′-UTR-derived Putative riboswitch
rli6223645082364337172lmo2277<-<-<-lmo22785′-UTR-derived Putative riboswitch.
rli632613301??atpI<-<-<-lmo25375′-UTR-derived Putative riboswitch
rliA513584513807224lmo0476<->->-lmo0477snRNA
rliB544357544716360lmo0509->->->lmo0510sRNA
rliC11543091154671363lmo1117->-><-lmo1118sRNA
rliD13595291359202328rpsO-><-->pnpAsRNA antisense
rliE15845861584808223comC<--><-folCsRNA antisense to comC mRNA
rliF21062922106073220nadA-><-<-lmo2026snRNA
rliG23869922386715278lmo2302<-<-<-lmo2303sRNA
rliH11808261181254429lmo1150<-->->lmo1151sRNA antisense
rliI28422002841962239lmo2760<-<-->lmo2761sRNA
sbrA [5] 1399363139943370lmo1374->->->lmo1375sRNA

aArrows indicate the sense of the gene on the genome. Bold arrows indicate gene absent from L. innocua.

Listeria monocytogenes EGD-e strain was used in these studies EMBL accession AL591824.1

Characterised non-coding RNAs

IDRfam
SAM RF00162
LhrC RF00616
TPP RF00059
glmS RF00234
PreQ1 RF00522
T-box RF00230
SsrS RF00013
IDRfam
LhrB RF00558
FMN RF00050
ssrA RF00023
SRP RF00169
PrfA RF00038
L10 leader RF00557
Purine RF00167
IDRfam
lysine RF00168
yybP-ykoY RF00080
glycine RF00504
L21 RF00559
RyrR RF00515
LhrA RF00615
L13 RF00555

References

  1. Mandin P, Repoila F, Vergassola M, Geissmann T, Cossart P (2007). "Identification of new noncoding RNAs in Listeria monocytogenes and prediction of mRNA targets". Nucleic Acids Res. 35 (3): 962–974. doi:10.1093/nar/gkl1096. PMC   1807966 . PMID   17259222.
  2. Toledo-Arana A, Dussurget O, Nikitas G, et al. (June 2009). "The Listeria transcriptional landscape from saprophytism to virulence". Nature. 459 (7249): 950–956. Bibcode:2009Natur.459..950T. doi:10.1038/nature08080. PMID   19448609.
  3. Burke TP, Loukitcheva A, Zemansky J, Wheeler R, Boneca IG, Portnoy DA (2014). "Listeria monocytogenes is resistant to lysozyme through the regulation, not the acquisition, of cell wall-modifying enzymes". J. Bacteriol. 196 (21): 3756–3767. doi:10.1128/JB.02053-14. PMC   4248804 . PMID   25157076.
  4. Burke TP, Portnoy DA (2016). "SpoVG Is a Conserved RNA-Binding Protein That Regulates Listeria monocytogenes Lysozyme Resistance, Virulence, and Swarming Motility". mBio. 7 (2) e00240-16. doi: 10.1128/mBio.00240-16 . PMC   4959528 . PMID   27048798.
  5. Nielsen JS, Olsen AS, Bonde M, Valentin-Hansen P, Kallipolitis BH (2008). "Identification of a sigma B-dependent small noncoding RNA in Listeria monocytogenes". J Bacteriol. 190 (18): 6264–6270. doi:10.1128/JB.00740-08. PMC   2546787 . PMID   18621897.