Toxin-antitoxin system

Last updated
(A) The vertical gene transfer of a toxin-antitoxin system. (B) Horizontal gene transfer of a toxin-antitoxin system. PSK stands for post-segregational killing and TA represents a locus encoding a toxin and an antitoxin. Toxin-antitoxin inheritance.png
(A) The vertical gene transfer of a toxin-antitoxin system. (B) Horizontal gene transfer of a toxin-antitoxin system. PSK stands for post-segregational killing and TA represents a locus encoding a toxin and an antitoxin.

A toxin-antitoxin system consists of a "toxin" and a corresponding "antitoxin", usually encoded by closely linked genes. The toxin is usually a protein while the antitoxin can be a protein or an RNA. Toxin-antitoxin systems are widely distributed in prokaryotes, and organisms often have them in multiple copies. [2] [3] When these systems are contained on plasmids  – transferable genetic elements – they ensure that only the daughter cells that inherit the plasmid survive after cell division. If the plasmid is absent in a daughter cell, the unstable antitoxin is degraded and the stable toxic protein kills the new cell; this is known as 'post-segregational killing' (PSK). [4] [5]

Contents

Toxin-antitoxin systems are typically classified according to how the antitoxin neutralises the toxin. In a type I toxin-antitoxin system, the translation of messenger RNA (mRNA) that encodes the toxin is inhibited by the binding of a small non-coding RNA antitoxin that binds the toxin mRNA. The toxic protein in a type II system is inhibited post-translationally by the binding of an antitoxin protein. Type III toxin-antitoxin systems consist of a small RNA that binds directly to the toxin protein and inhibits its activity. [6] There are also types IV-VI, which are less common. [7] Toxin-antitoxin genes are often inherited through horizontal gene transfer [8] [9] and are associated with pathogenic bacteria, having been found on plasmids conferring antibiotic resistance and virulence. [1]

Chromosomal toxin-antitoxin systems also exist, some of which are thought to perform cell functions such as responding to stresses, causing cell cycle arrest and bringing about programmed cell death. [1] [10] In evolutionary terms, toxin-antitoxin systems can be considered selfish DNA in that the purpose of the systems are to replicate, regardless of whether they benefit the host organism or not. Some have proposed adaptive theories to explain the evolution of toxin-antitoxin systems; for example, chromosomal toxin-antitoxin systems could have evolved to prevent the inheritance of large deletions of the host genome. [11] Toxin-antitoxin systems have several biotechnological applications, such as maintaining plasmids in cell lines, targets for antibiotics, and as positive selection vectors. [12]

Biological functions

Stabilization and fitness of mobile DNA

As stated above, toxin-antitoxin systems are well characterized as plasmid addiction modules. It was also proposed that toxin-antitoxin systems have evolved as plasmid exclusion modules. A cell that would carry two plasmids from the same incompatibility group will eventually generate two daughters cells carrying either plasmid. Should one of these plasmids encode for a TA system, its "displacement" by another TA-free plasmid system will prevent its inheritance and thus induce post-segregational killing. [13] This theory was corroborated through computer modelling. [14] Toxin-antitoxin systems can also be found on other mobile genetic elements such as conjugative transposons and temperate bacteriophages and could be implicated in the maintenance and competition of these elements. [15]

Genome stabilization

A chromosome map of Sinorhizobium meliloti, with its 25 chromosomal toxin-antitoxin systems. Orange-labelled loci are confirmed TA systems and green labels show putative systems. S meliloti strain 1021 TA map.png
A chromosome map of Sinorhizobium meliloti , with its 25 chromosomal toxin-antitoxin systems. Orange-labelled loci are confirmed TA systems and green labels show putative systems.

Toxin-antitoxin systems could prevent harmful large deletions in a bacterial genome, though arguably deletions of large coding regions are fatal to a daughter cell regardless. [11] In Vibrio cholerae, multiple type II toxin-antitoxin systems located in a super-integron were shown to prevent the loss of gene cassettes. [18]

Altruistic cell death

mazEF, a toxin-antitoxin locus found in E. coli and other bacteria, was proposed to induce programmed cell death in response to starvation, specifically a lack of amino acids. [19] This would release the cell's contents for absorption by neighbouring cells, potentially preventing the death of close relatives, and thereby increasing the inclusive fitness of the cell that perished. This would be an example of altruism and how bacterial colonies could resemble multicellular organisms. [14] However, the "mazEF-mediated PCD" has largely been refuted by several studies. [20] [21] [22]

Stress tolerance

Another theory states that chromosomal toxin-antitoxin systems are designed to be bacteriostatic rather than bactericidal. [23] RelE, for example, is a global inhibitor of translation, is induced during nutrient stress. By shutting down translation under stress, it could reduce the chance of starvation by lowering the cell's nutrient requirements. [24] However, it was shown that several toxin-antitoxin systems, including relBE, do not give any competitive advantage under any stress condition. [21]

Anti-addiction

It has been proposed that chromosomal homologues of plasmid toxin-antitoxin systems may serve as anti-addiction modules, which would allow progeny to lose a plasmid without suffering the effects of the toxin it encodes. [9] For example, a chromosomal copy of the ccdA antitoxin encoded in the chromosome of Erwinia chrysanthemi is able to neutralize the ccdB toxin encoded on the F plasmid and thus, prevent toxin activation when such a plasmid is lost. [25] Similarly, the ataR antitoxin encoded on the chromosome of E. coli O157:H7 is able neutralize the ataTP toxin encoded on plasmids found in other enterohemorragic E. coli. [26]

Phage protection

Type III toxin-antitoxin (AbiQ) systems have been shown to protect bacteria from bacteriophages altruistically. [27] [28] During an infection, bacteriophages hijack transcription and translation, which could prevent antitoxin replenishment and release toxin, triggering what is called an "abortive infection". [27] [28] Similar protective effects have been observed with type I, [29] type II, [30] and type IV (AbiE) [31] toxin-antitoxin systems.

Abortive initiation (Abi) can also happen without toxin-antitoxin systems, and many Abi proteins of other types exist. This mechanism serves to halt the replication of phages, protecting the overall population from harm. [32]

Antimicrobial persistence

When bacteria are challenged with antibiotics, a small and distinct subpopulation of cells is able to withstand the treatment by a phenomenon dubbed as "persistence" (not to be confused with resistance). [33] Due to their bacteriostatic properties, type II toxin-antitoxin systems have previously been thought to be responsible for persistence, by switching a fraction of the bacterial population to a dormant state. [34] However, this hypothesis has been widely invalidated. [35] [36] [37]

Selfish DNA

Toxin-antitoxin systems have been used as examples of selfish DNA as part of the gene centered view of evolution. It has been theorised that toxin-antitoxin loci serve only to maintain their own DNA, at the expense of the host organism. [1] [38] Thus, chromosomal toxin-antitoxin systems would serve no purpose and could be treated as "junk DNA". For example, the ccdAB system encoded in the chromosome of E. coli O157:H7 has been shown to be under negative selection, albeit at a slow rate due to its addictive properties. [8]

System types

Type I

The hok/sok type I toxin-antitoxin system Hok sok system R1 plasmid present.gif
The hok/sok type I toxin-antitoxin system

Type I toxin-antitoxin systems rely on the base-pairing of complementary antitoxin RNA with the toxin mRNA. Translation of the mRNA is then inhibited either by degradation via RNase III or by occluding the Shine-Dalgarno sequence or ribosome binding site of the toxin mRNA. Often the toxin and antitoxin are encoded on opposite strands of DNA. The 5' or 3' overlapping region between the two genes is the area involved in complementary base-pairing, usually with between 19–23 contiguous base pairs. [39]

Toxins of type I systems are small, hydrophobic proteins that confer toxicity by damaging cell membranes. [1] Few intracellular targets of type I toxins have been identified, possibly due to the difficult nature of analysing proteins that are poisonous to their bacterial hosts. [10] Also, the detection of small proteins has been challenging due to technical issues, a problem that remains to be solved with large-scale analysis. [40]

Type I systems sometimes include a third component. In the case of the well-characterised hok/sok system, in addition to the hok toxin and sok antitoxin, there is a third gene, called mok. This open reading frame almost entirely overlaps that of the toxin, and the translation of the toxin is dependent on the translation of this third component. [5] Thus the binding of antitoxin to toxin is sometimes a simplification, and the antitoxin in fact binds a third RNA, which then affects toxin translation. [39]

Example systems

ToxinAntitoxinNotesRef.
hok sok The original and best-understood type I toxin-antitoxin system (pictured), which stabilises plasmids in a number of gram-negative bacteria [39]
fst RNAII The first type I system to be identified in gram-positive bacteria [41]
tisB istR A chromosomal system induced in the SOS response [42]
dinQ agrB A chromosomal system induced in the SOS response [43]
ldrD rdlD A chromosomal system in Enterobacteriaceae [44]
flmA flmB A hok/sok homologue, which also stabilises the F plasmid [45]
ibs sib Discovered in E. coli intergenic regions, the antitoxin was originally named QUAD RNA [46]
txpA/brnT ratA Ensures the inheritance of the skin element during sporulation in Bacillus subtilis [47]
symE symR A chromosomal system induced in the SOS response [3]
XCV2162 ptaRNA1 A system identified in Xanthomonas campestris with erratic phylogenetic distribution. [48]
timPtimRA chromosomal system identified in Salmonella [49]
aapA1isoA1A type 1 TA module in Helicobacter pylori [50]
sprA1 sprA1as Located within S. aureus small Pathogenicity island (SaPI). SprA1 encodes for a small cytotoxic peptide, PepA1, which disrupts both S. aureus membranes and host erythrocytes. [51] [52]

Type II

The genetic context of a typical type II toxin-antitoxin locus, produced during a bioinformatics analysis Typical TA sys.png
The genetic context of a typical type II toxin-antitoxin locus, produced during a bioinformatics analysis

Type II toxin-antitoxin systems are generally better-understood than type I. [39] In this system a labile proteic antitoxin tightly binds and inhibits the activity of a stable toxin. [10] The largest family of type II toxin-antitoxin systems is vapBC , [53] which has been found through bioinformatics searches to represent between 37 and 42% of all predicted type II loci. [16] [17] Type II systems are organised in operons with the antitoxin protein typically being located upstream of the toxin, which helps to prevent expression of the toxin without the antitoxin. [54] The proteins are typically around 100 amino acids in length, [39] and exhibit toxicity in a number of ways: CcdB, for example, affects DNA replication by poisoning DNA gyrase [55] whereas toxins from the MazF family are endoribonucleases that cleave cellular mRNAs, [56] [57] tRNAs [58] [59] or rRNAs [60] at specific sequence motifs. The most common toxic activity is the protein acting as an endonuclease, also known as an interferase. [61] [62]

One of the key features of the TAs is the autoregulation. The antitoxin and toxin protein complex bind to the operator that is present upstream of the TA genes. This results in repression of the TA operon. The key to the regulation are (i) the differential translation of the TA proteins and (ii) differential proteolysis of the TA proteins. As explained by the "Translation-reponsive model", [63] the degree of expression is inversely proportional to the concentration of the repressive TA complex. The TA complex concentration is directly proportional to the global translation rate. The higher the rate of translation more TA complex and less transcription of TA mRNA. Lower the rate of translation, lesser the TA complex and higher the expression. Hence, the transcriptional expression of TA operon is inversely proportional to translation rate.

A third protein can sometimes be involved in type II toxin-antitoxin systems. in the case of the ω-ε-ζ (omega-epsilon-zeta) system, the omega protein is a DNA binding protein that negatively regulates the transcription of the whole system. [64] Similarly, the paaR2 protein regulates the expression of the paaR2-paaA2-parE2 toxin-antitoxin system. [65] Other toxin-antitoxin systems can be found with a chaperone as a third component. [66] This chaperone is essential for proper folding of the antitoxin, thus making the antitoxin addicted to its cognate chaperone.

Example systems

ToxinAntitoxinNotesRef.
ccdB ccdA Found on the F plasmid of Escherichia coli [55]
parE parD Found in multiple copies in Caulobacter crescentus [67]
mazFmazEFound in E. coli and in chromosomes of other bacteria [29]
yafOyafNA system induced by the SOS response to DNA damage in E. coli [68]
hicAhicBFound in archaea and bacteria [69]
kidkisStabilises the R1 plasmid and is related to the CcdB/A system [23]
ζ εFound mostly in Gram-positive bacteria [64]
ataTataRFound in enterohemorragic E. coli and Klebsiella spp. [70]

Type III

ToxN_toxin
Identifiers
SymbolToxN, type III toxin-antitoxin system
Pfam PF13958
Available protein structures:
Pfam   structures / ECOD  
PDB RCSB PDB; PDBe; PDBj
PDBsum structure summary

Type III toxin-antitoxin systems rely on direct interaction between a toxic protein and an RNA antitoxin. The toxic effects of the protein are neutralised by the RNA gene. [6] One example is the ToxIN system from the bacterial plant pathogen Erwinia carotovora . The toxic ToxN protein is approximately 170 amino acids long and has been shown to be toxic to E. coli . The toxic activity of ToxN is inhibited by ToxI RNA, an RNA with 5.5 direct repeats of a 36 nucleotide motif (AGGTGATTTGCTACCTTTAAGTGCAGCTAGAAATTC). [27] [71] Crystallographic analysis of ToxIN has found that ToxN inhibition requires the formation of a trimeric ToxIN complex, whereby three ToxI monomers bind three ToxN monomers; the complex is held together by extensive protein-RNA interactions. [72]

Type IV

Type IV toxin-antitoxin systems are similar to type II systems, because they consist of two proteins. Unlike type II systems, the antitoxin in type IV toxin-antitoxin systems counteracts the activity of the toxin, and the two proteins do not necessarily interact directly. DarTG1 and DarTG2 are type IV toxin-antitoxin systems that modify DNA. Their toxins add ADP-ribose to guanosine bases (DarT1 toxin) or thymidine bases (DarT2 toxin), and their antitoxins remove the toxic modifications (NADAR antitoxin from guanosine and DarG antitoxin from thymidine). [73] [74] [75] [76]

Type V

ghoST is a type V toxin-antitoxin system, in which the antitoxin (GhoS) cleaves the ghoT mRNA. This system is regulated by a type II system, mqsRA. [77]

Type VI

socAB is a type VI toxin-antitoxin system that was discovered in Caulobacter crescentus . The antitoxin, SocA, promotes degradation of the toxin, SocB, by the protease ClpXP. [78]

Type VII

Type VII has been proposed to include systems hha/tomB, tglT/takA and hepT/mntA, all of which neutralise toxin activity by post-translational chemical modification of amino acid residues. [79]

Type VIII

Type VIII includes the system creTA. In this system, the antitoxin creA serves as a guide RNA for a CRISPR-Cas system. Due to incomplete complementarity between the creA guide and the creAT promoter, the Cas complex does not cleave the DNA, but instead remains at the site, where it blocks access by RNA polymerase, preventing expression of the creT toxin (a natural instance of CRISPRi). When expressed, the creT RNA will sequester the rare arginine codon tRNAUCU, stalling translation and halting cell metabolism. [80]

Biotechnological applications

The biotechnological applications of toxin-antitoxin systems have begun to be realised by several biotechnology organisations. [12] [23] A primary usage is in maintaining plasmids in a large bacterial cell culture. In an experiment examining the effectiveness of the hok/sok locus, it was found that segregational stability of an inserted plasmid expressing beta-galactosidase was increased by between 8 and 22 times compared to a control culture lacking a toxin-antitoxin system. [81] [82] In large-scale microorganism processes such as fermentation, progeny cells lacking the plasmid insert often have a higher fitness than those who inherit the plasmid and can outcompete the desirable microorganisms. A toxin-antitoxin system maintains the plasmid thereby maintaining the efficiency of the industrial process. [12]

Additionally, toxin-antitoxin systems may be a future target for antibiotics. Inducing suicide modules against pathogens could help combat the growing problem of multi-drug resistance. [83]

Ensuring a plasmid accepts an insert is a common problem of DNA cloning. Toxin-antitoxin systems can be used to positively select for only those cells that have taken up a plasmid containing the inserted gene of interest, screening out those that lack the inserted gene. An example of this application comes from the ccdB-encoded toxin, which has been incorporated into plasmid vectors. [84] The gene of interest is then targeted to recombine into the ccdB locus, inactivating the transcription of the toxic protein. Thus, cells containing the plasmid but not the insert perish due to the toxic effects of CcdB protein, and only those that incorporate the insert survive. [12]

Another example application involves both the CcdB toxin and CcdA antitoxin. CcdB is found in recombinant bacterial genomes and an inactivated version of CcdA is inserted into a linearised plasmid vector. A short extra sequence is added to the gene of interest that activates the antitoxin when the insertion occurs. This method ensures orientation-specific gene insertion. [84]

Genetically modified organisms must be contained in a pre-defined area during research. [83] Toxin-antitoxin systems can cause cell suicide in certain conditions, such as a lack of a lab-specific growth medium they would not encounter outside of the controlled laboratory set-up. [23] [85]

See also

Related Research Articles

<span class="mw-page-title-main">Plasmid</span> Small DNA molecule within a cell

A plasmid is a small, extrachromosomal DNA molecule within a cell that is physically separated from chromosomal DNA and can replicate independently. They are most commonly found as small circular, double-stranded DNA molecules in bacteria; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that benefit the survival of the organism and confer selective advantage such as antibiotic resistance. While chromosomes are large and contain all the essential genetic information for living under normal conditions, plasmids are usually very small and contain only additional genes that may be useful in certain situations or conditions. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms. In the laboratory, plasmids may be introduced into a cell via transformation. Synthetic plasmids are available for procurement over the internet.

<span class="mw-page-title-main">Shiga toxin</span> Family of related toxins

Shiga toxins are a family of related toxins with two major groups, Stx1 and Stx2, expressed by genes considered to be part of the genome of lambdoid prophages. The toxins are named after Kiyoshi Shiga, who first described the bacterial origin of dysentery caused by Shigella dysenteriae. Shiga-like toxin (SLT) is a historical term for similar or identical toxins produced by Escherichia coli. The most common sources for Shiga toxin are the bacteria S. dysenteriae and some serotypes of Escherichia coli (STEC), which includes serotypes O157:H7, and O104:H4.

Addiction modules are toxin-antitoxin systems. Each consists of a pair of genes that specify two components: a stable toxin and an unstable antitoxin that interferes with the lethal action of the toxin. Found first in Escherichia coli on low copy number plasmids, addiction modules are responsible for a process called the postsegregational killing effect. When bacteria lose these plasmid(s), the cured cells are selectively killed because the unstable antitoxin is degraded faster than the more stable toxin. The term "addiction" is used because the cell depends on the de novo synthesis of the antitoxin for cell survival. Thus, addiction modules are implicated in maintaining the stability of extrachromosomal elements.

fis E. coli gene

fis is an E. coli gene encoding the Fis protein. The regulation of this gene is more complex than most other genes in the E. coli genome, as Fis is an important protein which regulates expression of other genes. It is supposed that fis is regulated by H-NS, IHF and CRP. It also regulates its own expression (autoregulation). Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions.

<span class="mw-page-title-main">Sib RNA</span>

Sib RNA refers to a group of related non-coding RNA. They were originally named QUAD RNA after they were discovered as four repeat elements in Escherichia coli intergenic regions. The family was later renamed Sib when it was discovered that the number of repeats is variable in other species and in other E. coli strains.

<span class="mw-page-title-main">Hok/sok system</span>

The hok/sok system is a postsegregational killing mechanism employed by the R1 plasmid in Escherichia coli. It was the first type I toxin-antitoxin pair to be identified through characterisation of a plasmid-stabilising locus. It is a type I system because the toxin is neutralised by a complementary RNA, rather than a partnered protein.

In a screen of the Bacillus subtilis genome for genes encoding ncRNAs, Saito et al. focused on 123 intergenic regions (IGRs) over 500 base pairs in length, the authors analyzed expression from these regions. Seven IGRs termed bsrC, bsrD, bsrE, bsrF, bsrG, bsrH and bsrI expressed RNAs smaller than 380 nt. All the small RNAs except BsrD RNA were expressed in transformed Escherichia coli cells harboring a plasmid with PCR-amplified IGRs of B. subtilis, indicating that their own promoters independently express small RNAs. Under non-stressed condition, depletion of the genes for the small RNAs did not affect growth. Although their functions are unknown, gene expression profiles at several time points showed that most of the genes except for bsrD were expressed during the vegetative phase, but undetectable during the stationary phase. Mapping the 5' ends of the 6 small RNAs revealed that the genes for BsrE, BsrF, BsrG, BsrH, and BsrI RNAs are preceded by a recognition site for RNA polymerase sigma factor σA.

<span class="mw-page-title-main">PtaRNA1</span> Family of non-coding RNAs

PtaRNA1 is a family of non-coding RNAs. Homologs of PtaRNA1 can be found in the bacterial families, Betaproteobacteria and Gammaproteobacteria. In all cases the PtaRNA1 is located anti-sense to a short protein-coding gene. In Xanthomonas campestris pv. vesicatoria, this gene is annotated as XCV2162 and is included in the plasmid toxin family of proteins.

<span class="mw-page-title-main">TisB-IstR toxin-antitoxin system</span> Biochemical process related to DNA damage

The TisB-IstR toxin-antitoxin system is the first known toxin-antitoxin system which is induced by the SOS response in response to DNA damage.

<span class="mw-page-title-main">LdrD-RdlD toxin-antitoxin system</span>

RdlD RNA is a family of small non-coding RNAs which repress the protein LdrD in a type I toxin-antitoxin system. It was discovered in Escherichia coli strain K-12 in a long direct repeat (LDR) named LDR-D. This locus encodes two products: a 35 amino acid peptide toxin (ldrD) and a 60 nucleotide RNA antitoxin. The 374nt toxin mRNA has a half-life of around 30 minutes while rdlD RNA has a half-life of only 2 minutes. This is in keeping with other type I toxin-antitoxin systems.

<span class="mw-page-title-main">SymE-SymR toxin-antitoxin system</span>

The SymE-SymR toxin-antitoxin system consists of a small symbiotic endonuclease toxin, SymE, and a non-coding RNA symbiotic RNA antitoxin, SymR, which inhibits SymE translation. SymE-SymR is a type I toxin-antitoxin system, and is under regulation by the antitoxin, SymR. The SymE-SymR complex is believed to play an important role in recycling damaged RNA and DNA. The relationship and corresponding structures of SymE and SymR provide insight into the mechanism of toxicity and overall role in prokaryotic systems.

<span class="mw-page-title-main">FlmA-FlmB toxin-antitoxin system</span>

The FlmA-FlmB toxin-antitoxin system consists of FlmB RNA, a family of non-coding RNAs and the protein toxin FlmA. The FlmB RNA transcript is 100 nucleotides in length and is homologous to sok RNA from the hok/sok system and fulfills the identical function as a post-segregational killing (PSK) mechanism.

<span class="mw-page-title-main">TxpA-RatA toxin-antitoxin system</span>

The TxpA/RatA toxin-antitoxin system was first identified in Bacillus subtilis. It consists of a non-coding 222nt sRNA called RatA and a protein toxin named TxpA.

par stability determinant

The par stability determinant is a 400 bp locus of the pAD1 plasmid which encodes a type I toxin-antitoxin system in Enterococcus faecalis. It was the first such plasmid addiction module to be found in gram-positive bacteria.

<i>Escherichia coli</i> sRNA

Escherichia coli contains a number of small RNAs located in intergenic regions of its genome. The presence of at least 55 of these has been verified experimentally. 275 potential sRNA-encoding loci were identified computationally using the QRNA program. These loci will include false positives, so the number of sRNA genes in E. coli is likely to be less than 275. A computational screen based on promoter sequences recognised by the sigma factor sigma 70 and on Rho-independent terminators predicted 24 putative sRNA genes, 14 of these were verified experimentally by northern blotting. The experimentally verified sRNAs included the well characterised sRNAs RprA and RyhB. Many of the sRNAs identified in this screen, including RprA, RyhB, SraB and SraL, are only expressed in the stationary phase of bacterial cell growth. A screen for sRNA genes based on homology to Salmonella and Klebsiella identified 59 candidate sRNA genes. From this set of candidate genes, microarray analysis and northern blotting confirmed the existence of 17 previously undescribed sRNAs, many of which bind to the chaperone protein Hfq and regulate the translation of RpoS. UptR sRNA transcribed from the uptR gene is implicated in suppressing extracytoplasmic toxicity by reducing the amount of membrane-bound toxic hybrid protein.

vapBC

VapBC is the largest family of type II toxin-antitoxin system genetic loci in prokaryotes. VapBC operons consist of two genes: VapC encodes a toxic PilT N-terminus (PIN) domain, and VapB encodes a matching antitoxin. The toxins in this family are thought to perform RNA cleavage, which is inhibited by the co-expression of the antitoxin, in a manner analogous to a poison and antidote.

<span class="mw-page-title-main">Fic/DOC protein family</span>

In molecular biology, the Fic/DOC protein family is a family of proteins which catalyzes the post-translational modification of proteins using phosphate-containing compound as a substrate. Fic domain proteins typically use ATP as a co-factor, but in some cases GTP or UTP is used. Post-translational modification performed by Fic domains is usually NMPylation, however they also catalyze phosphorylation and phosphocholine transfer. This family contains a central conserved motif HPFX[D/E]GNGR in most members and it carries the invariant catalytic histidine. Fic domain was found in bacteria, eukaryotes and archaea and can be found organized in almost hundred different multi-domain assemblies.

<span class="mw-page-title-main">CcdA/CcdB Type II Toxin-antitoxin system</span>

The CcdA/CcdB Type II Toxin-antitoxin system is one example of the bacterial toxin-antitoxin (TA) systems that encode two proteins, one a potent inhibitor of cell proliferation (toxin) and the other its specific antidote (antitoxin). These systems preferentially guarantee growth of plasmid-carrying daughter cells in a bacterial population by killing newborn bacteria that have not inherited a plasmid copy at cell division.

<span class="mw-page-title-main">ParDE type II toxin-antitoxin system</span>

The parDE type II toxin-antitoxin system is one example of the bacterial toxin-antitoxin (TA) systems that encode two proteins, one a potent inhibitor of cell proliferation (toxin) and the other its specific antidote (antitoxin). These systems preferentially guarantee growth of plasmid-carrying daughter cells in a bacterial population by killing newborn bacteria that have not inherited a plasmid copy at cell division.

UDP-N-acetylglucosamine kinase is an enzyme with systematic name ATP:UDP-N-acetyl-alpha-D-glucosamine 3'-phosphotransferase. This enzyme catalyses the following chemical reaction

References

  1. 1 2 3 4 5 Van Melderen L, Saavedra De Bast M (March 2009). Rosenberg SM (ed.). "Bacterial toxin-antitoxin systems: more than selfish entities?". PLOS Genetics. 5 (3): e1000437. doi: 10.1371/journal.pgen.1000437 . PMC   2654758 . PMID   19325885.
  2. ↑ Fozo EM, Makarova KS, Shabalina SA, Yutin N, Koonin EV, Storz G (June 2010). "Abundance of type I toxin-antitoxin systems in bacteria: searches for new candidates and discovery of novel families". Nucleic Acids Research. 38 (11): 3743–59. doi:10.1093/nar/gkq054. PMC   2887945 . PMID   20156992.
  3. 1 2 Gerdes K, Wagner EG (April 2007). "RNA antitoxins". Current Opinion in Microbiology. 10 (2): 117–24. doi:10.1016/j.mib.2007.03.003. PMID   17376733.
  4. ↑ Gerdes K (February 2000). "Toxin-antitoxin modules may regulate synthesis of macromolecules during nutritional stress". Journal of Bacteriology. 182 (3): 561–72. doi:10.1128/JB.182.3.561-572.2000. PMC   94316 . PMID   10633087.
  5. 1 2 Faridani OR, Nikravesh A, Pandey DP, Gerdes K, Good L (2006). "Competitive inhibition of natural antisense Sok-RNA interactions activates Hok-mediated cell killing in Escherichia coli". Nucleic Acids Research. 34 (20): 5915–22. doi:10.1093/nar/gkl750. PMC   1635323 . PMID   17065468.
  6. 1 2 Labrie SJ, Samson JE, Moineau S (May 2010). "Bacteriophage resistance mechanisms". Nature Reviews. Microbiology. 8 (5): 317–27. doi:10.1038/nrmicro2315. PMID   20348932. S2CID   205497795.
  7. ↑ Page R, Peti W (April 2016). "Toxin-antitoxin systems in bacterial growth arrest and persistence". Nature Chemical Biology. 12 (4): 208–14. doi:10.1038/nchembio.2044. PMID   26991085.
  8. 1 2 Mine N, Guglielmini J, Wilbaux M, Van Melderen L (April 2009). "The decay of the chromosomally encoded ccdO157 toxin-antitoxin system in the Escherichia coli species". Genetics. 181 (4): 1557–66. doi:10.1534/genetics.108.095190. PMC   2666520 . PMID   19189956.
  9. 1 2 Ramisetty BC, Santhosh RS (February 2016). "Horizontal gene transfer of chromosomal Type II toxin-antitoxin systems of Escherichia coli". FEMS Microbiology Letters. 363 (3): fnv238. doi: 10.1093/femsle/fnv238 . PMID   26667220.
  10. 1 2 3 Hayes F (September 2003). "Toxins-antitoxins: plasmid maintenance, programmed cell death, and cell cycle arrest". Science. 301 (5639): 1496–9. Bibcode:2003Sci...301.1496H. doi:10.1126/science.1088157. PMID   12970556. S2CID   10028255.
  11. 1 2 Rowe-Magnus DA, Guerout AM, Biskri L, Bouige P, Mazel D (March 2003). "Comparative analysis of superintegrons: engineering extensive genetic diversity in the Vibrionaceae". Genome Research. 13 (3): 428–42. doi:10.1101/gr.617103. PMC   430272 . PMID   12618374.
  12. 1 2 3 4 Stieber D, Gabant P, Szpirer C (September 2008). "The art of selective killing: plasmid toxin/antitoxin systems and their technological applications". BioTechniques. 45 (3): 344–6. doi: 10.2144/000112955 . PMID   18778262.
  13. ↑ Cooper TF, Heinemann JA (November 2000). "Postsegregational killing does not increase plasmid stability but acts to mediate the exclusion of competing plasmids". Proceedings of the National Academy of Sciences of the United States of America. 97 (23): 12643–8. Bibcode:2000PNAS...9712643C. doi: 10.1073/pnas.220077897 . PMC   18817 . PMID   11058151.
  14. 1 2 Mochizuki A, Yahara K, Kobayashi I, Iwasa Y (February 2006). "Genetic addiction: selfish gene's strategy for symbiosis in the genome". Genetics. 172 (2): 1309–23. doi:10.1534/genetics.105.042895. PMC   1456228 . PMID   16299387.
  15. ↑ Magnuson RD (September 2007). "Hypothetical functions of toxin-antitoxin systems". Journal of Bacteriology. 189 (17): 6089–92. doi:10.1128/JB.00958-07. PMC   1951896 . PMID   17616596.
  16. 1 2 Pandey DP, Gerdes K (2005). "Toxin-antitoxin loci are highly abundant in free-living but lost from host-associated prokaryotes". Nucleic Acids Research. 33 (3): 966–76. doi:10.1093/nar/gki201. PMC   549392 . PMID   15718296.
  17. 1 2 3 Sevin EW, Barloy-Hubler F (2007). "RASTA-Bacteria: a web-based tool for identifying toxin-antitoxin loci in prokaryotes". Genome Biology. 8 (8): R155. doi: 10.1186/gb-2007-8-8-r155 . PMC   2374986 . PMID   17678530.
  18. ↑ Szekeres S, Dauti M, Wilde C, Mazel D, Rowe-Magnus DA (March 2007). "Chromosomal toxin-antitoxin loci can diminish large-scale genome reductions in the absence of selection". Molecular Microbiology. 63 (6): 1588–605. doi:10.1111/j.1365-2958.2007.05613.x. PMID   17367382. S2CID   28191383.
  19. ↑ Aizenman E, Engelberg-Kulka H, Glaser G (June 1996). "An Escherichia coli chromosomal "addiction module" regulated by guanosine [corrected] 3',5'-bispyrophosphate: a model for programmed bacterial cell death". Proceedings of the National Academy of Sciences of the United States of America. 93 (12): 6059–63. Bibcode:1996PNAS...93.6059A. doi: 10.1073/pnas.93.12.6059 . PMC   39188 . PMID   8650219.
  20. ↑ Ramisetty BC, Natarajan B, Santhosh RS (February 2015). "mazEF-mediated programmed cell death in bacteria: "what is this?"". Critical Reviews in Microbiology. 41 (1): 89–100. doi:10.3109/1040841X.2013.804030. PMID   23799870. S2CID   34286252.
  21. 1 2 Tsilibaris V, Maenhaut-Michel G, Mine N, Van Melderen L (September 2007). "What is the benefit to Escherichia coli of having multiple toxin-antitoxin systems in its genome?". Journal of Bacteriology. 189 (17): 6101–8. doi:10.1128/JB.00527-07. PMC   1951899 . PMID   17513477.
  22. ↑ Ramisetty BC, Raj S, Ghosh D (December 2016). "Escherichia coli MazEF toxin-antitoxin system does not mediate programmed cell death". Journal of Basic Microbiology. 56 (12): 1398–1402. doi:10.1002/jobm.201600247. PMID   27259116. S2CID   1685755.
  23. 1 2 3 4 Diago-Navarro E, Hernandez-Arriaga AM, López-Villarejo J, Muñoz-Gómez AJ, Kamphuis MB, Boelens R, Lemonnier M, Díaz-Orejas R (August 2010). "parD toxin-antitoxin system of plasmid R1--basic contributions, biotechnological applications and relationships with closely-related toxin-antitoxin systems". The FEBS Journal. 277 (15): 3097–117. doi: 10.1111/j.1742-4658.2010.07722.x . PMID   20569269.
  24. ↑ Christensen SK, Mikkelsen M, Pedersen K, Gerdes K (December 2001). "RelE, a global inhibitor of translation, is activated during nutritional stress". Proceedings of the National Academy of Sciences of the United States of America. 98 (25): 14328–33. Bibcode:2001PNAS...9814328C. doi: 10.1073/pnas.251327898 . PMC   64681 . PMID   11717402.
  25. ↑ Saavedra De Bast M, Mine N, Van Melderen L (July 2008). "Chromosomal toxin-antitoxin systems may act as antiaddiction modules". Journal of Bacteriology. 190 (13): 4603–9. doi:10.1128/JB.00357-08. PMC   2446810 . PMID   18441063.
  26. ↑ Jurėnas D, Garcia-Pino A, Van Melderen L (September 2017). "Novel toxins from type II toxin-antitoxin systems with acetyltransferase activity". Plasmid. 93: 30–35. doi: 10.1016/j.plasmid.2017.08.005 . PMID   28941941.
  27. 1 2 3 Fineran PC, Blower TR, Foulds IJ, Humphreys DP, Lilley KS, Salmond GP (January 2009). "The phage abortive infection system, ToxIN, functions as a protein-RNA toxin-antitoxin pair". Proceedings of the National Academy of Sciences of the United States of America. 106 (3): 894–9. Bibcode:2009PNAS..106..894F. doi: 10.1073/pnas.0808832106 . PMC   2630095 . PMID   19124776.
  28. 1 2 Emond E, Dion E, Walker SA, Vedamuthu ER, Kondo JK, Moineau S (December 1998). "AbiQ, an abortive infection mechanism from Lactococcus lactis". Applied and Environmental Microbiology. 64 (12): 4748–56. Bibcode:1998ApEnM..64.4748E. doi:10.1128/AEM.64.12.4748-4756.1998. PMC   90918 . PMID   9835558.
  29. 1 2 Hazan R, Engelberg-Kulka H (September 2004). "Escherichia coli mazEF-mediated cell death as a defense mechanism that inhibits the spread of phage P1". Molecular Genetics and Genomics. 272 (2): 227–34. doi:10.1007/s00438-004-1048-y. PMID   15316771. S2CID   28840747.
  30. ↑ Pecota DC, Wood TK (April 1996). "Exclusion of T4 phage by the hok/sok killer locus from plasmid R1". Journal of Bacteriology. 178 (7): 2044–50. doi:10.1128/jb.178.7.2044-2050.1996. PMC   177903 . PMID   8606182.
  31. ↑ Dy RL, Przybilski R, Semeijn K, Salmond GP, Fineran PC (April 2014). "A widespread bacteriophage abortive infection system functions through a Type IV toxin-antitoxin mechanism". Nucleic Acids Research. 42 (7): 4590–605. doi:10.1093/nar/gkt1419. PMC   3985639 . PMID   24465005.
  32. ↑ Seed KD (June 2015). "Battling Phages: How Bacteria Defend against Viral Attack". PLOS Pathogens. 11 (6): e1004847. doi: 10.1371/journal.ppat.1004847 . PMC   4465916 . PMID   26066799.
  33. ↑ Kussell E, Kishony R, Balaban NQ, Leibler S (April 2005). "Bacterial persistence: a model of survival in changing environments". Genetics. 169 (4): 1807–14. doi:10.1534/genetics.104.035352. PMC   1449587 . PMID   15687275.
  34. ↑ Maisonneuve E, Gerdes K (April 2014). "Molecular mechanisms underlying bacterial persisters". Cell. 157 (3): 539–48. doi: 10.1016/j.cell.2014.02.050 . PMID   24766804.
  35. ↑ Ramisetty BC, Ghosh D, Roy Chowdhury M, Santhosh RS (2016). "What Is the Link between Stringent Response, Endoribonuclease Encoding Type II Toxin-Antitoxin Systems and Persistence?". Frontiers in Microbiology. 7: 1882. doi: 10.3389/fmicb.2016.01882 . PMC   5120126 . PMID   27933045.
  36. ↑ Harms A, Fino C, Sørensen MA, Semsey S, Gerdes K (December 2017). "Prophages and Growth Dynamics Confound Experimental Results with Antibiotic-Tolerant Persister Cells". mBio. 8 (6): e01964–17. doi:10.1128/mBio.01964-17. PMC   5727415 . PMID   29233898.
  37. ↑ Goormaghtigh F, Fraikin N, Putrinš M, Hallaert T, Hauryliuk V, Garcia-Pino A, Sjödin A, Kasvandik S, Udekwu K, Tenson T, Kaldalu N, Van Melderen L (June 2018). "Reassessing the Role of Type II Toxin-Antitoxin Systems in Formation of Escherichia coli Type II Persister Cells". mBio. 9 (3): e00640–18. doi:10.1128/mBio.00640-18. PMC   6016239 . PMID   29895634.
  38. ↑ Ramisetty BC, Santhosh RS (July 2017). "Endoribonuclease type II toxin-antitoxin systems: functional or selfish?". Microbiology. 163 (7): 931–939. doi: 10.1099/mic.0.000487 . PMID   28691660. S2CID   3879598.
  39. 1 2 3 4 5 Fozo EM, Hemm MR, Storz G (December 2008). "Small toxic proteins and the antisense RNAs that repress them". Microbiology and Molecular Biology Reviews. 72 (4): 579–89, Table of Contents. doi:10.1128/MMBR.00025-08. PMC   2593563 . PMID   19052321.
  40. ↑ Sberro H, Fremin BJ, Zlitni S, Edfors F, Greenfield N, Snyder MP, et al. (August 2019). "Large-Scale Analyses of Human Microbiomes Reveal Thousands of Small, Novel Genes". Cell. 178 (5): 1245–1259.e14. doi:10.1016/j.cell.2019.07.016. PMC   6764417 . PMID   31402174.
  41. ↑ Greenfield TJ, Ehli E, Kirshenmann T, Franch T, Gerdes K, Weaver KE (August 2000). "The antisense RNA of the par locus of pAD1 regulates the expression of a 33-amino-acid toxic peptide by an unusual mechanism". Molecular Microbiology. 37 (3): 652–60. doi: 10.1046/j.1365-2958.2000.02035.x . PMID   10931358.(subscription required)
  42. ↑ Vogel J, Argaman L, Wagner EG, Altuvia S (December 2004). "The small RNA IstR inhibits synthesis of an SOS-induced toxic peptide". Current Biology. 14 (24): 2271–6. doi: 10.1016/j.cub.2004.12.003 . PMID   15620655.
  43. ↑ Weel-Sneve R, Kristiansen KI, Odsbu I, Dalhus B, Booth J, Rognes T, Skarstad K, Bjørås M (February 7, 2013). "Single transmembrane peptide DinQ modulates membrane-dependent activities". PLOS Genetics. 9 (2): e1003260. doi: 10.1371/journal.pgen.1003260 . PMC   3567139 . PMID   23408903.
  44. ↑ Kawano M, Oshima T, Kasai H, Mori H (July 2002). "Molecular characterization of long direct repeat (LDR) sequences expressing a stable mRNA encoding for a 35-amino-acid cell-killing peptide and a cis-encoded small antisense RNA in Escherichia coli". Molecular Microbiology. 45 (2): 333–49. doi: 10.1046/j.1365-2958.2002.03042.x . PMID   12123448.(subscription required)
  45. ↑ Loh SM, Cram DS, Skurray RA (June 1988). "Nucleotide sequence and transcriptional analysis of a third function (Flm) involved in F-plasmid maintenance". Gene. 66 (2): 259–68. doi:10.1016/0378-1119(88)90362-9. PMID   3049248.
  46. ↑ Fozo EM, Kawano M, Fontaine F, Kaya Y, Mendieta KS, Jones KL, Ocampo A, Rudd KE, Storz G (December 2008). "Repression of small toxic protein synthesis by the Sib and OhsC small RNAs". Molecular Microbiology. 70 (5): 1076–93. doi:10.1111/j.1365-2958.2008.06394.x. PMC   2597788 . PMID   18710431.(subscription required)
  47. ↑ Silvaggi JM, Perkins JB, Losick R (October 2005). "Small untranslated RNA antitoxin in Bacillus subtilis". Journal of Bacteriology. 187 (19): 6641–50. doi:10.1128/JB.187.19.6641-6650.2005. PMC   1251590 . PMID   16166525.
  48. ↑ Findeiss S, Schmidtke C, Stadler PF, Bonas U (March 2010). "A novel family of plasmid-transferred anti-sense ncRNAs". RNA Biology. 7 (2): 120–4. doi: 10.4161/rna.7.2.11184 . PMID   20220307.
  49. ↑ Andresen L, Martínez-Burgo Y, Nilsson Zangelin J, Rizvanovic A, Holmqvist E (November 2020). "Salmonella Protein TimP Targets the Cytoplasmic Membrane and Is Repressed by the Small RNA TimR". mBio. 11 (6): e01659–20, /mbio/11/6/mBio.01659–20.atom. doi: 10.1128/mBio.01659-20 . PMC   7667032 . PMID   33172998.
  50. ↑ Arnion H, Korkut DN, Masachis Gelo S, Chabas S, Reignier J, Iost I, Darfeuille F (May 2017). "Mechanistic insights into type I toxin antitoxin systems in Helicobacter pylori: the importance of mRNA folding in controlling toxin expression". Nucleic Acids Research. 45 (8): 4782–4795. doi: 10.1093/nar/gkw1343 . PMC   5416894 . PMID   28077560.
  51. ↑ Sayed N, Jousselin A, Felden B (December 2011). "A cis-antisense RNA acts in trans in Staphylococcus aureus to control translation of a human cytolytic peptide". Nature Structural & Molecular Biology. 19 (1): 105–12. doi:10.1038/nsmb.2193. PMID   22198463. S2CID   8217681.
  52. ↑ Sayed N, Nonin-Lecomte S, Réty S, Felden B (December 2012). "Functional and structural insights of a Staphylococcus aureus apoptotic-like membrane peptide from a toxin-antitoxin module". The Journal of Biological Chemistry. 287 (52): 43454–63. doi: 10.1074/jbc.M112.402693 . PMC   3527932 . PMID   23129767.
  53. ↑ Robson J, McKenzie JL, Cursons R, Cook GM, Arcus VL (July 2009). "The vapBC operon from Mycobacterium smegmatis is an autoregulated toxin-antitoxin module that controls growth via inhibition of translation". Journal of Molecular Biology. 390 (3): 353–67. doi:10.1016/j.jmb.2009.05.006. PMID   19445953.
  54. ↑ Deter HS, Jensen RV, Mather WH, Butzin NC (July 2017). "Mechanisms for Differential Protein Production in Toxin-Antitoxin Systems". Toxins. 9 (7): 211. doi: 10.3390/toxins9070211 . PMC   5535158 . PMID   28677629.
  55. 1 2 Bernard P, Couturier M (August 1992). "Cell killing by the F plasmid CcdB protein involves poisoning of DNA-topoisomerase II complexes". Journal of Molecular Biology. 226 (3): 735–45. doi:10.1016/0022-2836(92)90629-X. PMID   1324324.
  56. ↑ Zhang Y, Zhang J, Hoeflich KP, Ikura M, Qing G, Inouye M (October 2003). "MazF cleaves cellular mRNAs specifically at ACA to block protein synthesis in Escherichia coli". Molecular Cell. 12 (4): 913–23. doi: 10.1016/s1097-2765(03)00402-7 . PMID   14580342.
  57. ↑ Culviner PH, Laub MT (June 2018). "Global Analysis of the E. coli Toxin MazF Reveals Widespread Cleavage of mRNA and the Inhibition of rRNA Maturation and Ribosome Biogenesis". Molecular Cell. 70 (5): 868–880.e10. doi: 10.1016/j.molcel.2018.04.026 . PMC   8317213 . PMID   29861158.
  58. ↑ Barth VC, Zeng JM, Vvedenskaya IO, Ouyang M, Husson RN, Woychik NA (July 2019). "Toxin-mediated ribosome stalling reprograms the Mycobacterium tuberculosis proteome". Nature Communications. 10 (1): 3035. Bibcode:2019NatCo..10.3035B. doi:10.1038/s41467-019-10869-8. PMC   6620280 . PMID   31292443.
  59. ↑ Barth VC, Woychik NA (2019). "The Sole Mycobacterium smegmatis MazF Toxin Targets tRNALys to Impart Highly Selective, Codon-Dependent Proteome Reprogramming". Frontiers in Genetics. 10: 1356. doi: 10.3389/fgene.2019.01356 . PMC   7033543 . PMID   32117414.
  60. ↑ Schifano JM, Edifor R, Sharp JD, Ouyang M, Konkimalla A, Husson RN, Woychik NA (May 2013). "Mycobacterial toxin MazF-mt6 inhibits translation through cleavage of 23S rRNA at the ribosomal A site". Proceedings of the National Academy of Sciences of the United States of America. 110 (21): 8501–6. Bibcode:2013PNAS..110.8501S. doi: 10.1073/pnas.1222031110 . PMC   3666664 . PMID   23650345.
  61. ↑ Christensen-Dalsgaard M, Overgaard M, Winther KS, Gerdes K (2008). "Chapter 25 RNA Decay by Messenger RNA Interferases". RNA Turnover in Bacteria, Archaea and Organelles. Methods in Enzymology. Vol. 447. pp. 521–35. doi:10.1016/S0076-6879(08)02225-8. ISBN   978-0-12-374377-0. PMID   19161859.
  62. ↑ Yamaguchi Y, Inouye M (2009). mRNA interferases, sequence-specific endoribonucleases from the toxin-antitoxin systems. Progress in Molecular Biology and Translational Science. Vol. 85. pp. 467–500. doi:10.1016/S0079-6603(08)00812-X. ISBN   978-0-12-374761-7. PMID   19215780.
  63. ↑ Ramisetty BC (2020). "Regulation of Type II Toxin-Antitoxin Systems: The Translation-Responsive Model". Frontiers in Microbiology. 11: 895. doi: 10.3389/fmicb.2020.00895 . PMC   7214741 . PMID   32431690.
  64. 1 2 Mutschler H, Meinhart A (December 2011). "ε/ζ systems: their role in resistance, virulence, and their potential for antibiotic development". Journal of Molecular Medicine. 89 (12): 1183–94. doi:10.1007/s00109-011-0797-4. PMC   3218275 . PMID   21822621.
  65. ↑ Hallez R, Geeraerts D, Sterckx Y, Mine N, Loris R, Van Melderen L (May 2010). "New toxins homologous to ParE belonging to three-component toxin-antitoxin systems in Escherichia coli O157:H7" (PDF). Molecular Microbiology. 76 (3): 719–32. doi: 10.1111/j.1365-2958.2010.07129.x . PMID   20345661.
  66. ↑ Bordes P, Cirinesi AM, Ummels R, Sala A, Sakr S, Bitter W, Genevaux P (May 2011). "SecB-like chaperone controls a toxin-antitoxin stress-responsive system in Mycobacterium tuberculosis". Proceedings of the National Academy of Sciences of the United States of America. 108 (20): 8438–43. Bibcode:2011PNAS..108.8438B. doi: 10.1073/pnas.1101189108 . PMC   3100995 . PMID   21536872.
  67. ↑ Fiebig A, Castro Rojas CM, Siegal-Gaskins D, Crosson S (July 2010). "Interaction specificity, toxicity and regulation of a paralogous set of ParE/RelE-family toxin-antitoxin systems". Molecular Microbiology. 77 (1): 236–51. doi:10.1111/j.1365-2958.2010.07207.x. PMC   2907451 . PMID   20487277.(subscription required)
  68. ↑ Singletary LA, Gibson JL, Tanner EJ, McKenzie GJ, Lee PL, Gonzalez C, Rosenberg SM (December 2009). "An SOS-regulated type 2 toxin-antitoxin system". Journal of Bacteriology. 191 (24): 7456–65. doi:10.1128/JB.00963-09. PMC   2786605 . PMID   19837801.
  69. ↑ Jørgensen MG, Pandey DP, Jaskolska M, Gerdes K (February 2009). "HicA of Escherichia coli defines a novel family of translation-independent mRNA interferases in bacteria and archaea". Journal of Bacteriology. 191 (4): 1191–9. doi:10.1128/JB.01013-08. PMC   2631989 . PMID   19060138.
  70. ↑ Jurėnas D, Chatterjee S, Konijnenberg A, Sobott F, Droogmans L, Garcia-Pino A, Van Melderen L (June 2017). "fMet" (PDF). Nature Chemical Biology. 13 (6): 640–646. doi:10.1038/nchembio.2346. PMID   28369041.
  71. ↑ Blower TR, Fineran PC, Johnson MJ, Toth IK, Humphreys DP, Salmond GP (October 2009). "Mutagenesis and functional characterization of the RNA and protein components of the toxIN abortive infection and toxin-antitoxin locus of Erwinia". Journal of Bacteriology. 191 (19): 6029–39. doi:10.1128/JB.00720-09. PMC   2747886 . PMID   19633081.
  72. ↑ Blower TR, Pei XY, Short FL, Fineran PC, Humphreys DP, Luisi BF, Salmond GP (February 2011). "A processed noncoding RNA regulates an altruistic bacterial antiviral system". Nature Structural & Molecular Biology. 18 (2): 185–90. doi:10.1038/nsmb.1981. PMC   4612426 . PMID   21240270.
  73. ↑ Brown JM, Shaw KJ (November 2003). "A novel family of Escherichia coli toxin-antitoxin gene pairs". Journal of Bacteriology. 185 (22): 6600–8. doi:10.1128/jb.185.22.6600-6608.2003. PMC   262102 . PMID   14594833.
  74. ↑ Jankevicius G, Ariza A, Ahel M, Ahel I (December 2016). "The Toxin-Antitoxin System DarTG Catalyzes Reversible ADP-Ribosylation of DNA". Molecular Cell. 64 (6): 1109–1116. doi:10.1016/j.molcel.2016.11.014. PMC   5179494 . PMID   27939941.
  75. ↑ Schuller M, Butler RE, Ariza A, Tromans-Coia C, Jankevicius G, Claridge TD, et al. (August 2021). "Molecular basis for DarT ADP-ribosylation of a DNA base". Nature. 596 (7873): 597–602. Bibcode:2021Natur.596..597S. doi:10.1038/s41586-021-03825-4. hdl: 2299/25013 . PMID   34408320. S2CID   237214909.
  76. ↑ Schuller, Marion; Raggiaschi, Roberto; Mikolcevic, Petra; Rack, Johannes G. M.; Ariza, Antonio; Zhang, YuGeng; Ledermann, Raphael; Tang, Christoph; Mikoc, Andreja; Ahel, Ivan (2023-07-06). "Molecular basis for the reversible ADP-ribosylation of guanosine bases". Molecular Cell. 83 (13): 2303–2315.e6. doi: 10.1016/j.molcel.2023.06.013 . ISSN   1097-2765. PMID   37390817. S2CID   259304277.
  77. ↑ Wang X, Lord DM, Hong SH, Peti W, Benedik MJ, Page R, Wood TK (June 2013). "Type II toxin/antitoxin MqsR/MqsA controls type V toxin/antitoxin GhoT/GhoS". Environmental Microbiology. 15 (6): 1734–44. Bibcode:2013EnvMi..15.1734W. doi:10.1111/1462-2920.12063. PMC   3620836 . PMID   23289863.
  78. ↑ Aakre CD, Phung TN, Huang D, Laub MT (December 2013). "A bacterial toxin inhibits DNA replication elongation through a direct interaction with the β sliding clamp". Molecular Cell. 52 (5): 617–28. doi:10.1016/j.molcel.2013.10.014. PMC   3918436 . PMID   24239291.
  79. ↑ Wang X, Yao J, Sun YC, Wood TK (May 2021). "Type VII Toxin/Antitoxin Classification System for Antitoxins that Enzymatically Neutralize Toxins". Trends in Microbiology. 29 (5): 388–393. doi:10.1016/j.tim.2020.12.001. PMID   33342606. S2CID   229341165.
  80. ↑ Li, Ming; Gong, Luyao; Cheng, Feiyue; Yu, Haiying; Zhao, Dahe; Wang, Rui; Wang, Tian; Zhang, Shengjie; Zhou, Jian; Shmakov, Sergey A.; Koonin, Eugene V.; Xiang, Hua (2021-04-30). "Toxin-antitoxin RNA pairs safeguard CRISPR-Cas systems". Science. 372 (6541): eabe5601. doi:10.1126/science.abe5601. ISSN   0036-8075. PMID   33926924. S2CID   233448823.
  81. ↑ Wu K, Jahng D, Wood TK (1994). "Temperature and growth rate effects on the hok/sok killer locus for enhanced plasmid stability". Biotechnology Progress. 10 (6): 621–9. doi:10.1021/bp00030a600. PMID   7765697. S2CID   34815594.
  82. ↑ Pecota DC, Kim CS, Wu K, Gerdes K, Wood TK (May 1997). "Combining the hok/sok, parDE, and pnd postsegregational killer loci to enhance plasmid stability". Applied and Environmental Microbiology. 63 (5): 1917–24. Bibcode:1997ApEnM..63.1917P. doi:10.1128/AEM.63.5.1917-1924.1997. PMC   168483 . PMID   9143123.
  83. 1 2 Gerdes K, Christensen SK, Løbner-Olesen A (May 2005). "Prokaryotic toxin-antitoxin stress response loci". Nature Reviews. Microbiology. 3 (5): 371–82. doi:10.1038/nrmicro1147. PMID   15864262. S2CID   13417307.
  84. 1 2 Bernard P, Gabant P, Bahassi EM, Couturier M (October 1994). "Positive-selection vectors using the F plasmid ccdB killer gene". Gene. 148 (1): 71–4. doi:10.1016/0378-1119(94)90235-6. PMID   7926841.
  85. ↑ Torres B, Jaenecke S, Timmis KN, García JL, Díaz E (December 2003). "A dual lethal system to enhance containment of recombinant micro-organisms". Microbiology. 149 (Pt 12): 3595–601. doi: 10.1099/mic.0.26618-0 . PMID   14663091.

This page is based on this Wikipedia article
Text is available under the CC BY-SA 4.0 license; additional terms may apply.
Images, videos and audio are available under their respective licenses.