Haplogroup Q-L804 (Y-DNA)

Last updated
Haplogroup Q-L804
Possible time of origin3,000-15,000 years ago
Possible place of origin Beringia: Either East Asia or North Asia
Ancestor Q-L54
DescendantsQ-Y9052, Q-A13540, Q-JN15, Q-Y16137, Q-Y7582
Defining mutationsL804 (rs1952836)

Haplogroup Q-L804 (Y-DNA) is a Y-chromosome DNA haplogroup. Haplogroup Q-L804 is a subclade of Haplogroup Q-L54. Currently Q-L804 is Q1b1a1b below Q1b-M346. [1]

Contents

In 2000 the research group at Oxford University headed by Dr. Agnar Helgason first discovered the haplotype that was much later to become known as Q-L804. In 2000 the strange haplotype was called "branch-A" (i.e. R1b-branch A) and it was found uniquely on Iceland and Scandinavia. [2] Later studies completed the genetic bridge by determining that Q-L804 is related to Q-M242 populations of Native Americans (Q-M3, Q-Z780) and Siberian populations of the Selkup and Ket people (Q-L330). [3] [4]

Origin and distribution

The origin of Haplogroup Q-L804 is uncertain. However it is likely to have originated in Beringia (North East Siberia) c. 15000 to 17000 yBP since it is closely linked to Q-M3 and to other haplogroups linked to the indigenous peoples of the Americas (over 90% of indigenous people in Meso & South America). Today, Q-L804 is found mainly in Norway and Sweden and in regions of North West Europe of Viking Age Expansion (British Isles, Atlantic Isles, Northern Germany, Normandy and Poland). The Q-L804 is also found among descendants of Scandinavian immigrants to North America. Haplogroup Q-L804 is defined by the presence of the (L804) single-nucleotide polymorphism (SNP). Q-L804 occurred on the Q-L54 lineage roughly 10-15 thousand years ago as the migration into the Americas was underway. It is likely that the split between Q-M3 and Q-L804 happened in the ancestors of the indigenous peoples of the Americas.

North Europe

Populations carrying Q-L804 are extremely thinly distributed throughout Northern Europe and among recent North European immigrants to North America. Since the discovery and definition of Q-L804 in 2014, three main subclades of Q-L804 bearing populations have been discovered in North Europe. The Q-Y9052 , the Q-JN14 and Q-Y7582. Of these three branches Q-JN14 has the widest distribution, ranging from Poland to Iceland, British Isles and France. Q-L804 is one of two subclades known as Q Nordic among genealogical communities. The Q-L527 is the other subclad of the Q Nordic.

Subclade distribution

Q-Y9052 (BY459). This lineage is found in Sweden, Norway and Germany.

Q-JN14 It has been found in Norway, Iceland, British Isles, Germany, France and Poland.

Q-Y7582 (BY386). This lineage has been found in Scotland, Iceland and England.

Technical specification of mutation

The L804 was discovered and defined by Thomas Krahn of Family Tree DNA's Genomics Research Center in 2012. [5] The technical details of L804 are:

Nucleotide change: T to A
Position (base pair):
Total size (base pairs):
Forward 5′→ 3′: GAATTCTGTGGGTGACTTTGTG
Reverse 5′→ 3′: GCACAGTGAAGAATGTGGGAC
Position: chrY:11,907,522
dbSNP151: rs765685783

Associated SNPs

Q-L804 is defined by the SNPs L804 and L805 and E324.

Phylogentic tree and Subgroups

Current status of the polygenetic tree for Q-L804 is published by Pinotti et al. in the article Y Chromosome Sequences Reveal a Short Beringian Standstill, Rapid Expansion, and early Population structure of Native American Founders. Calibrated phylogeny of Y haplogroup Q-L804 and its relation to the other branches of Q-L54. [6]

Yfull.com's phylogenetic tree ver. 6.08.01 for for haplogroup Q-L804. Yfull's tree also include estimation of the age of the branches, and TMRCA (Time to Most Recent Common Ancestor)

Family Tree DNA Y-DNA haplotree for haplogroup Q-L804

The subtree Q-BY387 is found on Iceland, Scotland and England. The Q-JN14 is widely distributed in North-west Europe, but most kits are from Norway. The subtree Q-BY459 is by FT DNA mainly found in Sweden and Norway.

See also

Y-DNA Q-M242 subclades

Y-DNA backbone tree

References

  1. Y-DNA Haplogroup Q and its Subclades - 2019, ISOGG
  2. Helgason, Agnar; Stefánsson, Kári (September 2000). "Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland". American Journal of Human Genetics. 67 (3): 697–717. doi:10.1086/303046. PMC   1287529 . PMID   10931763.
  3. Kivisild, Toomas (March 2017). "The study of human Y chromosome variation through ancient DNA". Human Genetics. 136 (5): 529–546. doi:10.1007/s00439-017-1773-z. PMC   5418327 . PMID   28260210.
  4. Karafet, Tatiana M.; Osipova, Ludmila P.; Savina, Olga V.; Hallmark, Brian; Hammer, Michael F. (2018). "Siberian genetic diversity reveals complex origins of the Samoyedic-speaking populations". American Journal of Human Biology. 30 (6) e23194. doi:10.1002/ajhb.23194. ISSN   1042-0533. PMID   30408262.
  5. "Y-DNA Haplogroup Q and its Subclades - 2012". International Society of Genetic Genealogy. 7 August 2012. Archived from the original on 2019-10-13. Retrieved 13 October 2019.
  6. Pinotti, Thomaz; Bergström, Anders; Geppert, Maria; Bawn, Matt; Ohasi, Dominique; Shi, Wentao; Lacerda, Daniela R.; Solli, Arne; Norstedt, Jakob; Reed, Kate; Dawtry, Kim; González-Andrade, Fabricio; Paz-y-Miño, Cesar; Revollo, Susana; Cuellar, Cinthia; Jota, Marilza S.; Santos, José E.; Ayub, Qasim; Kivisild, Toomas; Sandoval, José R.; Fujita, Ricardo; Xue, Yali; Roewer, Lutz; Santos, Fabrício R.; Tyler-Smith, Chris (2018). "Y Chromosome Sequences Reveal a Short Beringian Standstill, Rapid Expansion, and early Population structure of Native American Founders". Current Biology. 29 (1): 149–157.e3. doi: 10.1016/j.cub.2018.11.029 . hdl: 20.500.12727/6107 . ISSN   0960-9822. PMID   30581024.