TEX9

Last updated
TEX9
Identifiers
Aliases TEX9 , testis expressed 9
External IDs MGI: 1201610 HomoloGene: 32072 GeneCards: TEX9
Orthologs
SpeciesHumanMouse
Entrez

374618

21778

Ensembl

ENSG00000151575

ENSMUSG00000090626

UniProt

Q8N6V9

Q9D845

RefSeq (mRNA)

NM_001286449
NM_198524

NM_009359

RefSeq (protein)

NP_001273378
NP_940926

NP_033385

Location (UCSC) Chr 15: 56.24 – 56.45 Mb Chr 9: 72.45 – 72.49 Mb
PubMed search [3] [4]
Wikidata
View/Edit Human View/Edit Mouse

Testis-expressed protein 9 is a protein that in humans is encoded the TEX9 gene. TEX9 that encodes a 391-long amino acid protein containing two coiled-coil regions. [5] The gene is conserved in many species and encodes orthologous proteins in eukarya, archaea, and one species of bacteria. [6] The function of TEX9 is not yet fully understood, but it is suggested to have ATP-binding capabilities. [5]

Contents

Gene

Locus

TEX9 is located at 15q21.3 and has 18 exons. [5] However, some exons overlap; therefore, there are only 13 distinguishable exons in the human genome. [7] TEX9 is on the sense strand and spans from base 56,365,573 to 56,428,441. TEX9 is located in the gene neighborhood of CD24P2, RFX7, MNS1, and HMGB1P33. [5] [8]

Transcription Regulation

The promoter for TEX9 was determined using 19 supporting transcripts to be GXP_7531542, spanning from base 56,364,254 to base 56,365,775 on the sense strand of chromosome 15. [9] A number of transcription factors with a matrix similarity greater than or equal to 0.780 that are predicted to regulate transcription of TEX9 are listed below with their respective binding site:

Transcription FactorBinding SiteStrand
Estrogen response elements (ER alpha)ATTGGTCAGGCTGGTCTTG+
Retinoid receptor-related testis-associated receptorCCGACCAGAACTTGAGGGT and

TTGTAATTCAAGGTCATAA

- and +
Hypermethylated in cancer 1CTCTGCCCAGCCT and CTTCACCCGTGAT+ and -
T-box TF TBX21, dimeric binding siteTACTGCTTTTGGTGTCATATCTAAG+
Sine oculis homeobox homolog 4CTTTTGGTGTCATAT+
Ecotropic viral integration site 1 encoded factor, amino-terminal zinc finger domainAAAACCACAGTATAGAT-
Estrogen-related receptor alpha GAATTGTAATTCAAGGTCATAAA and AGTGATTTGCCCAAGG/CCATATA+ and +
Regulatory factor X, 4TTAGGTCTTTGATACATT and AGCCATTGGCGCAGCGTCA+ and -
Thyroid hormone receptor, beta TCGAGGATTCAAATCCAGAAACT and CTGGTATGTAGTATAGTGCCA- and -
Homeodomain protein NKX3.2ACTGTGAAGTGGGCACTAT+
Lentivirus LTR TATA boxCCATATAACTGGTAAGT+
Cdx-2 mammalian caudal related intestinal TFGTTCCGGTATATTGACCAT-
GA binding protein TF, alphaCTCTCGCGGGAAGATGCGTCG+
Olfactory neuron-specific factorACCTTTGAGAGCGCCCTTCTACG-
Kidney-enriched kruppel-like factorGAAGATGGCGGGGCGAAGT+
Expression of TEX9 in human tissue samples Expression for TEX9 in humans.jpg
Expression of TEX9 in human tissue samples

Expression

The expression of TEX9 is highest in the testis, followed by the thyroid, duodenum, and kidney, although other tissues have been shown to express TEX9. [5] TEX9 is expected to have a subcellular localization in the cytoplasm or nucleus. [10]

mRNA

Characteristics of Isoform 1

Isoform 1 of TEX9 has a 5' UTR region of 27 base pairs and a 3' UTR region of 356 base pairs. [11] The transcript is 1,559 base pairs long. [12]

Additional Primary Sequence and Variants (Isoforms)

Less common isoforms of TEX9 include isoforms: 2, X1, X2, X3, X4, X5, and X6. [5]

Protein

The theoretical molecular weight of the 391 amino acid TEX9 protein is 45kDa and the theoretical pI is 6. [13] However, the experimental molecular weight has been shown to be ~55kDa. [14]

Domains, Motifs, and Secondary Structure

The most pronounced domains in TEX9 are the two coiled-coil regions, which include amino acids 32-59 and 194-351. [15] Repetitive domains within the protein include ALEE (34-37 and 302-305) and EKYK (251-254 and 307-310). [16] TEX9 has more glutamate, lysine, and glutamine residues and less glycine residues compared to a typical human protein. [16]

Post-translational Modifications

TEX9 has been shown to be phosphorylated at tyrosine (Y) residues 85 and 264, and have a ubiquitylation site at the lysine (K) residue at 159. [12] It is predicted that there are multiple other phosphorylation, glycation, 0-beta-GlcNAc, and SUMO protein attachment sites. [17] [18] [19] [20]

Tertiary Structure

TEX9 isoform 1 with phosphorylation (orange) and ubiquitylation (blue) sites. The structure has 99% confidence and 98% coverage. TEX9 structure.png
TEX9 isoform 1 with phosphorylation (orange) and ubiquitylation (blue) sites. The structure has 99% confidence and 98% coverage.

TEX9's two coiled-coil regions make up its tertiary structure and can be visualized using the predicted structure from Phyre2. [10] Shown on the structure are the two known phosphorylated sites and one ubiquitylation site.

Quaternary Structure and Protein Interactions

TEX9 has been experimentally determined to have interactions including coiled-coil containing 112 (CCDC112), chromosome 20 open reading frame 112 (C20orf112), and nucleolar protein 4 (NOL4). [21] Textmining has suggested that TEX9 also interacts with olfactory receptor, family 4, subfamily C, member 3, odorant receptor (OR4C3). [21] Other interactions include gene products of human genes NOL4-2 (at an unknown location), GOGA2 (in the cis-Golgi network membrane, spindle pole of cytoskeleton, and ER-Golgi intermediate compartment membrane), and KDM1A (in the nucleus). [13] Another proposed interaction between TEX9 involves attachment with the SUMO protein, which has a molecular weight of 11kDa. [20] The realized MW of TEX9 is 55kDa but the theoretical MW is 45kDa, which provides evidence for this interaction. [22]

Homology and Evolution

Paralogs

There are no paralogs of TEX9 in humans. [23]

Orthologs

TEX9 has homologs in over 260 other organisms, including vertebrates, invertebrates, archaea, and one species of bacteria. [5] TEX9 has been found in all clades of organisms except land plants. [23]

Genus speciesCommon NameTaxonomic GroupDivergence (MYA)Accession NumberSeq. Length (aa)Corr. ID to HP (%)Corr. Sim. To HP (%)
Homo sapiens Human Hominini 0NP_940926.1391100100
Pan paniscus Bonobo Primate 6.65XP_008951441.13919999
Loxodonta africana African bush/savanna elephant Mammal 105XP_010596294.13918390
Apteryx rowi Okarito (brown) kiwi Bird 312XP_025916696.14226174
Gekko japonicus Calling gecko Reptile 312XP_015264647.13594963
Xenopus laevis African clawed frog Amphibian 352XP_018108534.14346076
Astyanax mexicanus Mexican tetra/blind cave fish Bony fish 432XP_007244936.23945168
Apostichopus japonicus Japanese (spiky) sea cucumber Echinodermata 684PIK45906.14044356
Capitella teleta Capitella Annelida 797ELT92672.12573445
Anoplophora glabripennis Asian long-horned beetle Mollusca 797XP_018561745.12591831
Pocillopora damicornis Cauliflower (lace) coral Cnidaria 824XP_027039795.13874260
Clonorchis sinensis Chinese liver fluke Platyhelminthes 824RJW72461.19522741
Echinococcus multilocularis Echinococcus Platyhelminthes 824CDS43228.12991833
Trichoplax sp. H2 Trichoplax Placozoa 948RDD37208.14513044
Amphimedon queenslandica Amphimedon Porifera 951.8XP_003384031.23392741
Spizellomyces punctatus DAOM BR117 Spizellomyces Chytrid (fungi)1105XP_016611327.13733152
Planoprotostelium fungivorumPlanoprotostelium Amoebozoa (protist)1480PRP73397.13731218
Klebsormidium nitens Klebsormidium Charophyte (green algae)1496GAQ91967.13452945
Hondaea fermentalgianaHondaea Stramenopiles (protist)1768GBG25987.13792235
Thecamonas trahens ATCC 50062 Thecamonas Apusozoa (protist)2101XP_013753981.13241323
Chlamydia trachomatis Chlamydia Bacteria 4290CPS19605.1721414
TEX9's mutation rate compared to fibrinogen, beta-globin, and cytochrome c. Relative mutation rate of TEX9.jpg
TEX9's mutation rate compared to fibrinogen, beta-globin, and cytochrome c.

The relative rate of change for TEX9 is fairly slow compared to fibrinogen and beta-globin, but not as slow as cytochrome c. [24]

Homologous Domains

TEX9 sequences that are most conserved between humans and other organisms are found within the two coiled-coil regions, where some amino acids are conserved in vertebrates, invertebrates, and microorganisms. The bacterial ortholog is most similar to vertebrates than invertebrates or microorganisms.

Phylogeny

Unrooted phylogenetic tree of TEX9 orthologs. Branch length represents relative evolutionary distance between organisms. Unrooted phylogenetic tree TEX9.jpg
Unrooted phylogenetic tree of TEX9 orthologs. Branch length represents relative evolutionary distance between organisms.

All of the orthologs of TEX9 are derived from the same common ancestor except the gene found in Chlamydia, which is thought to have transferred from humans into the bacterium. [25]

Clinical significance

Pathology

No diseases have been shown to be directly linked to TEX9, but some correlations have been found regarding estrogen receptor knockdown and increased TEX9 expression [26] as well as colorectal cancer cells with decreased TEX9 expression. [27]

Disease Association

Reduced expression of TEX9 has been shown to boost tumor growth in immunocompetent mice but not in immunocompromised mice. [28] This result suggested that TEX9 may function as a tumor antigen in some tumors. Mutations of the TEX9 protein have been found in 1-2% of tumors taken from certain cancers, including endometrial, head and neck, colorectal, and squamous lung. [29]

Related Research Articles

<span class="mw-page-title-main">Interferon-inducible GTPase 5</span> Protein-coding gene in the species Homo sapiens

Interferon-inducible GTPase 5 also known as immunity-related GTPase cinema 1 (IRGC1) is an enzyme that in humans is coded by the IRGC gene. It is predicted to behave like other proteins in the p47-GTPase-like and IRG families. It is most expressed in the testis.

Coiled-coil domain containing protein 180 (CCDC180) is a protein that in humans is encoded by the CCDC180 gene. This protein is known to localize to the nucleus and is thought to be involved in regulation of transcription as are many proteins containing coiled-coil domains. As it is expressed most highly in the testes and is regulated by SRY and SOX transcription factors, it could be involved in sex determination.

<span class="mw-page-title-main">Glutamate rich 5</span> Protein-coding gene in the species Homo sapiens

Glutamate rich protein 5 is a protein in humans encoded by the ERICH5 gene, also known as chromosome 8 open reading frame 47 (C8orf47).

<span class="mw-page-title-main">C16orf46</span> Human gene

Chromosome 16 open reading frame 46 is a protein of yet to be determined function in Homo sapiens. It is encoded by the C16orf46 gene with NCBI accession number of NM_001100873. It is a protein-coding gene with an overlapping locus.

<span class="mw-page-title-main">C15orf39</span>

C15orf39 is a protein that in humans is encoded by the Chromosome 15 open reading frame 15 (C15orf39) gene.

<span class="mw-page-title-main">TMEM44</span> Protein-coding gene in the species Homo sapiens

TMEM44 is a protein that in humans is encoded by the TMEM44 gene. DKFZp686O18124 is a synonym of TMEM44.

<span class="mw-page-title-main">NBPF19</span> Protein-coding gene in the species Homo sapiens

Neuroblastoma breakpoint family member 19, or NBPF19, is a protein that in humans is encoded by the NBPF19 gene. This protein is included in the neuroblastoma breakpoint family of proteins.

C2orf81 is a human gene encoding protein c2orf81, which is predicted to have nuclear localization.

<span class="mw-page-title-main">C4orf51</span> Protein-coding gene in the species Homo sapiens

Chromosome 4 open reading frame 51 (C4orf51) is a protein which in humans is encoded by the C4orf51 gene.

<span class="mw-page-title-main">CFAP299</span> Protein-coding gene in the species Homo sapiens

Cilia- and flagella-associated protein 299 (CFAP299), is a protein that in humans is encoded by the CFAP299 gene. CFAP299 is predicted to play a role in spermatogenesis and cell apoptosis.

Chromosome 1 open reading frame (C1orf167) is a protein which in humans is encoded by the C1orf167 gene. The NCBI accession number is NP_001010881. The protein is 1468 amino acids in length with a molecular weight of 162.42 kDa. The mRNA sequence was found to be 4689 base pairs in length.

<span class="mw-page-title-main">SMCO3</span> Protein-coding gene in the species Homo sapiens

Single-pass membrane and coiled-coil domain-containing protein 3 is a protein that is encoded in humans by the SMCO3 gene.

Proline-rich protein 16 (PRR16) is a protein coding gene in Homo sapiens. The protein is known by the alias Largen.

<span class="mw-page-title-main">C16orf90</span> Protein-coding gene in the species Homo sapiens

C16orf90 or chromosome 16 open reading frame 90 produces uncharacterized protein C16orf90 in homo sapiens. C16orf90's protein has four predicted alpha-helix domains and is mildly expressed in the testes and lowly expressed throughout the body. While the function of C16orf90 is not yet well understood by the scientific community, it has suspected involvement in the biological stress response and apoptosis based on expression data from microarrays and post-translational modification data.

<span class="mw-page-title-main">C1orf122</span> Protein-coding gene in the species Homo sapiens

C1orf122 is a gene in the human genome that encodes the cytosolic protein ALAESM.. ALAESM is present in all tissue cells and highly up-regulated in the brain, spinal cord, adrenal gland and kidney. This gene can be expressed up to 2.5 times the average gene in its highly expressed tissues. Although the function of C1orf122 is unknown, it is predicted to be used for mitochondria localization.

<span class="mw-page-title-main">KRBA1</span> Protein-coding gene in the species Homo sapiens

KRBA1 is a protein that in humans is encoded by the KRBA1 gene. It is located on the plus strand of chromosome 7 from 149,411,872 to 149,431,664. It is also commonly known under two other aliases: KIAA1862 and KRAB A Domain Containing 1 gene and encodes the KRBA1 protein in humans. The KRBA family of genes is understood to encode different transcriptional repressor proteins

<span class="mw-page-title-main">C12orf24</span> Protein-coding gene in humans

C12orf24 is a gene in humans that encodes a protein known as FAM216A. This gene is primarily expressed in the testis and brain, but has constitutive expression in 25 other tissues. FAM216A is an intracellular protein that has been predicted to reside within the nucleus of cells. The exact function of C12orf24 is unknown. FAM216A is highly expressed in Sertoli cells of the testis as well as different stage spermatids.

TMEM275 is a protein that in humans is encoded by the TMEM275 gene. TMEM275 has two, highly-conserved, helical trans-membrane regions. It is predicted to reside within the plasma membrane or the endoplasmic reticulum's membrane.

<span class="mw-page-title-main">C13orf46</span> C13of46 Gene and Protein

Chromosome 13 Open Reading Frame 46 is a protein which in humans is encoded by the C13orf46 gene. In humans, C13orf46 is ubiquitously expressed at low levels in tissues, including the lungs, stomach, prostate, spleen, and thymus. This gene encodes eight alternatively spliced mRNA transcript, which produce five different protein isoforms.

<span class="mw-page-title-main">ZNF839</span>

ZNF839 or zinc finger protein 839 is a protein which in humans is encoded by the ZNF839 gene. It is located on the long arm of chromosome 14. Zinc finger protein 839 is speculated to pay a role in humoral immune response to cancer as a renal carcinoma antigen (NY-REN-50). This is because NY-REN-50 was found to be over expressed in cancer patients, especially those with renal carcinoma. Zinc finger protein 839 also plays a role in transcription regulation by metal-ion binding since it binds to DNA via C2H2-type zinc finger repeats.

References

  1. 1 2 3 GRCh38: Ensembl release 89: ENSG00000151575 - Ensembl, May 2017
  2. 1 2 3 GRCm38: Ensembl release 89: ENSMUSG00000090626 - Ensembl, May 2017
  3. ↑ "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  4. ↑ "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  5. 1 2 3 4 5 6 7 "TEX9 testis expressed 9 [Homo sapiens (human)] - Gene - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2019-02-08.
  6. ↑ "BLAST: Basic Local Alignment Search Tool". blast.ncbi.nlm.nih.gov. Retrieved 2019-02-25.
  7. ↑ "User Sequence vs Genomic". genome.ucsc.edu. Retrieved 2019-02-25.
  8. ↑ "Human BLAT Search". genome.ucsc.edu. Retrieved 2019-04-21.
  9. ↑ "Genomatix: Login Page". www.genomatix.de. Retrieved 2019-05-05.
  10. 1 2 3 "Phyre 2 alignment of TEX9_____ with c1ciiA_". www.sbg.bio.ic.ac.uk. Retrieved 2019-05-05.
  11. ↑ "Sequence Utilities". www.bioline.com. Retrieved 2019-05-05.
  12. 1 2 "testis-expressed protein 9 isoform 1 [Homo sapiens] - Protein - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2019-02-08.
  13. 1 2 "TEX9 - Testis-expressed protein 9 - Homo sapiens (Human) - TEX9 gene & protein". www.uniprot.org. Retrieved 2019-02-08.
  14. ↑ "TEX9 - Antibodies - The Human Protein Atlas". www.proteinatlas.org. Retrieved 2019-05-05.
  15. ↑ "COILS Server". embnet.vital-it.ch. Archived from the original on 2019-07-12. Retrieved 2019-04-21.
  16. 1 2 "SAPS < Sequence Statistics < EMBL-EBI". www.ebi.ac.uk. Retrieved 2019-04-21.
  17. ↑ "NetPhos 3.1 Server". www.cbs.dtu.dk. Retrieved 2019-05-05.
  18. ↑ "YinOYang 1.2 Server". www.cbs.dtu.dk. Retrieved 2019-05-05.
  19. ↑ "NetGlycate 1.0 Server". www.cbs.dtu.dk. Retrieved 2019-05-05.
  20. 1 2 "SUMOplot™ Analysis Program | Abgent". www.abgent.com. Archived from the original on 2005-01-03. Retrieved 2019-05-05.
  21. 1 2 "TEX9 protein (human) - STRING interaction network". version-10-5.string-db.org. Retrieved 2019-02-08.
  22. ↑ "SUMO Prediction". Archived from the original on 3 January 2005. Retrieved 20 April 2019.
  23. 1 2 "Protein BLAST: search protein databases using a protein query". blast.ncbi.nlm.nih.gov. Retrieved 2019-04-21.
  24. ↑ "TimeTree :: The Timescale of Life". timetree.org. Retrieved 2019-05-05.
  25. ↑ "Bacteria and Humans Have Been Swapping DNA for Millennia". The Scientist Magazine®. Retrieved 2019-05-05.
  26. ↑ "GDS4061 / 243198_at". www.ncbi.nlm.nih.gov. Retrieved 2019-04-21.
  27. ↑ "GDS4511 / 243198_at". www.ncbi.nlm.nih.gov. Retrieved 2019-04-21.
  28. ↑ Shuptrine CW, Ajina R, Fertig EJ, Jablonski SA, Kim Lyerly H, Hartman ZC, Weiner LM (December 2017). "An unbiased in vivo functional genomics screening approach in mice identifies novel tumor cell-based regulators of immune rejection". Cancer Immunology, Immunotherapy. 66 (12): 1529–1544. doi:10.1007/s00262-017-2047-2. PMC   5854209 . PMID   28770278.
  29. ↑ "TEX9 (human)". www.phosphosite.org. Retrieved 2019-02-08.
This page is based on this Wikipedia article
Text is available under the CC BY-SA 4.0 license; additional terms may apply.
Images, videos and audio are available under their respective licenses.