Haplogroup I-M253

Last updated
Haplogroup I1 (M253)
Possible time of origin3,170–4,600 [1] –5,070 BP (today's diversification) [2] [3] (previously 11,000 BP [4] to 33,000 BP [5] ) 27,500 (diversification with I2-FGC77992) [1]
Possible place of origin Northern Europe [6]
Ancestor I* (M170)
DescendantsI1a (DF29/S438);
I1b (S249/Z131);
I1c (Y18119/Z17925)
Defining mutationsM253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187

Haplogroup I-M253, also known as I1, is a Y chromosome haplogroup. The genetic markers confirmed as identifying I-M253 are the SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187. [7] It is a primary branch of Haplogroup I-M170 (I*).

Contents

Haplogroup I1 is believed to have been present among Upper Paleolithic European hunter-gatherers as a minor lineage but due to its near-total absence in pre-Neolithic DNA samples it cannot have been very widespread. Neolithic I1 samples are very sparse as well, suggesting a rapid dispersion connected to a founder effect in the Nordic Bronze Age. Today it reaches its peak frequencies in Sweden (52 percent of males in Västra Götaland County) and western Finland (more than 50 percent in Satakunta province). [8] In terms of national averages, I-M253 is found in 38-39% of Swedish males, [9] [10] [8] 37% of Norwegian males, [11] [12] [13] 34.8% of Danish males, [14] [15] [16] 34.5% of Icelandic males, [17] [18] [19] and about 28% of Finnish males. [20] Bryan Sykes, in his 2006 book Blood of the Isles, gives the members – and the notional founding patriarch of I1 the name "Wodan". [21]

All known living members descend from a common ancestor 6 times younger than the common ancestor with I2. [1]

Before a reclassification in 2008, [22] the group was known as I1a, a name that has since been reassigned to a primary branch, haplogroup I-DF29. The other primary branches of I1 (M253) are I1b (S249/Z131) and I1c (Y18119/Z17925).

More than 99% of living men with I1 belong to the DF29 branch which is estimated to have emerged in 2400 BCE. [23] [24] All DF29 men share a common ancestor born between 2500 and 2400 BCE. [25] The oldest ancient individual with I1-DF29 found is Oll009, a man from early Bronze Age Sweden. [26] [27]

A 2024 study found that I1-M253 expanded rapidly during a migration from the eastern or northeastern parts of Scandinavia into Southern Sweden, Denmark and Norway around 2000 BC and was associated with the introduction of stone cist burials. [28] The study concluded that the spread of Y-DNA haplogroup I1 was associated with a genetic cluster labelled as "LNBA phase III" and that this genetic cluster formed the predominant ancestry source for Bronze Age, Iron Age and Viking Age Scandinavians, as well as other ancient European groups with a documented Scandinavian or Germanic association (for example, Anglo-Saxons and Goths; Extended Data Fig. 6e).

Origins

Map of the early Nordic Bronze Age, where I1 first became prominent. The Nordic Bronze Age is often considered ancestral to the Germanic peoples. Nordic Bronze Age.png
Map of the early Nordic Bronze Age, where I1 first became prominent. The Nordic Bronze Age is often considered ancestral to the Germanic peoples.

While haplogroup I1 most likely diverged from I* as early as 27,000 years ago in the Gravettian, so far DNA studies have only been able to locate it in three Paleolithic and Mesolithic hunter-gatherers. As of November 2022, only 6 ancient DNA samples from human remains dating to earlier than the Nordic Bronze Age have been assigned to haplogroup I1:

Despite the high frequency of haplogroup I1 in present-day Scandinavians, I1 is completely absent among early agriculturalist DNA samples from Neolithic Scandinavia. [41] [42] [32] Except for a single DNA sample (SF11), it is also absent from Mesolithic hunter-gatherers in Scandinavia. I1 first starts to appear in Scandinavia in notable frequency during the late Neolithic in conjunction with the entrance of groups carrying Western Steppe Herder ancestry into Scandinavia, but does not increase significantly in frequency until the beginning of the Nordic Bronze Age. [37] [43] [44]

Due to the very low number of ancient DNA samples that have been assigned to I1 that date to earlier than the Nordic Bronze Age, it is currently unknown whether I1 was present as a rare haplogroup among Scandinavian forager cultures such as Pitted Ware before becoming assimilated by the Battle Axe culture, or if it was brought into Scandinavia by incoming groups such as Battle Axe who may have assimilated it from cultures such as the Funnelbeaker culture in Central Europe; or the steppe itself. Future research will most likely be able to determine which one of these two possible origins turns out to be the case.

Samples SF11 and BAB5 are unlike other ancient DNA samples assigned to I1 in the sense that they both seem to represent now-extinct branches of I1 that hadn't fully developed into I-M253 yet. They are therefore unlikely to have been ancestral to present-day carriers of I1, who all share a common ancestor that lived around 2600 BC.

According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in Chalcolithic Europe. [2] A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques. [3]

In 2007, it was suggested that it initially dispersed from the area that is now Denmark. [14] However, Prof. Dr. Kenneth Nordtvedt, Montana State University, regarding the MRCA, in 2009 wrote in a personal message: "We don't know where that man existed, but the greater lower Elbe basin seems like the heartland of I1".

Latest results (January 2022) published by Y-Full suggest I1 (I-M253) was formed 27,500 ybp (95 CI: 29,800 ybp – 25,200 ybp) with TMRCA 4,600 ybp (95 CI: 5,200 ybp – 4,000 ybp). Since the most up-to date calculated estimation of TMRCA of I1 is thought to be around 2600 BC, this likely puts the ancestor of all living I1 men somewhere in Northern Europe around that time. The phylogeny of I1 shows the signature of a rapid star-like expansion. [45] [46] This suggests that I1 went from being a rare marker to a rather common one in a rapid burst. [3]

Structure

I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1  [7]

Historical expansion

A timeline of the early Germanic expansions Germanic expansion timeline.jpg
A timeline of the early Germanic expansions

Haplogroup I1, as well as subclades of R1b such as R1b-Z18 and subclades of R1a such as R1a-Z284, are strongly associated with Germanic peoples and are linked to the proto-Germanic speakers of the Nordic Bronze Age. [47] [48] Current DNA research indicates that I1 was close to non-existent in most of Europe outside of Scandinavia and northern Germany before the Migration Period. The expansion of I1 is directly tied to that of the Germanic tribes. Starting around 900 BC, Germanic tribes started moving out of southern Scandinavia and northern Germany into the nearby lands between the Elbe and the Oder. Between 600 and 300 BC another wave of Germanic peoples migrated across the Baltic Sea and settled alongside the Vistula. Germanic migration to that area resulted in the formation of the Wielbark culture, which is associated with the Goths. [49]

I1-Z63 has been traced to the Kowalewko burial site in Poland which dates to the Roman Iron Age. In 2017 Polish researchers could successfully assign YDNA haplogroups to 16 individuals who were buried at the site. Out of these 16 individuals, 8 belonged to I1. In terms of subclades, three belonged to I-Z63, and in particular subclade I-L1237. [50] The Kowalewko archeological site has been associated with the Wielbark culture. Therefore, the subclade I-L1237 of I-Z63 may be seen somewhat as a genetic indicator of the Gothic tribe of late antiquity. I1-Z63 has also been found in a burial associated with Goth and Lombard remains in Collegno, Italy. [51] [52] The cemetery is dated to the late 6th Century and further suggests that I1-Z63 and downstream subclades are linked to early Medieval Gothic migrations.

In 2015, a DNA study tested the Y-DNA haplogroups of 12 samples dated to 300–400 AD from Saxony-Anhalt in Germany. 8 of them belonged to haplogroup I1. This DNA evidence is in alignment with the historical migrations of Germanic tribes from Scandinavia to central Europe. [53]

Additionally, I1-Z63 was found in the Late Antiquity site Crypta Balbi in Rome, this time with the downstream subclade I-Y7234. [54] Material findings associated with the Lombards have been excavated in Crypta Balbi.

The Pla de l'Horta villa near Girona in Spain is located in close proximity to a necropolis with a series of tombs associated with the Visigoths. The grave goods and the typology of the tombs point to a Visigothic origin of the individuals. A small number of individuals buried at the site were sampled for DNA analysis in a 2019 study. One of the samples belonged to haplogroup I1. [55] This finding is in accordance with the common ancestral origin of the Visigoths and the Ostrogoths.

The Anglo-Saxon settlement of Britain introduced I1 to the British Isles. [56] A 2022 study found that out of 120 samples from Anglo-Saxon period England, 41 samples or roughly 34.17% of the samples belonged to haplogroup I1. The study noted that there was a heavy correlation between "CNE" Continental North European-like ancestry and Y-DNA I1. [57]

During the Viking Age, I-M253 saw another expansion. Margaryan et al. 2020 analyzed 442 Viking world individuals from various archaeological sites in Europe. I-M253 was the most common Y-haplogroup found in the study. Norwegian and Danish Vikings brought more I1 to Britain and Ireland, while Swedish Vikings introduced it to Russia and Ukraine and brought more of it to Finland and Estonia. [58]

Geographical distribution

I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking Age, or modern times. It is found in all places invaded by the Norse.

During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the United States, Australia, New Zealand and Canada.

PopulationSample sizeI (total)I1 (I-M253)I1a1a (I-M227)Source
Albanians (Tirana)5521.82%=(12/55)3.6%=(2/55)0.0Battaglia et al. 2008
Albanians (North Macedonia)6417.2%=(11/64)4.7%=(3/64)0.0Battaglia et al. 2008
Albanians (Tirana)
Albanians (North Macedonia)		55+64=11919.33%=(23/119)4.2%=(5/119)0.0Battaglia et al. 2008
Kosovo Albanians (Pristina)1147.96%=(9/114)5.31%=(6/114)0.0Pericic et al. 2005
Albanians (Tirana)
Albanians (North Macedonia)
Kosovo Albanians (Pristina)		55+64+114=23313.73%=(32/233)4.72%=(11/233)0.0Pericic et al. 2005
Battaglia et al. 2008
Austria439.32.30.0Underhill et al. 2007
Belarus: Vitbsk100151.00.0Underhill et al. 2007
Belarus: Brest9720.61.00.0Underhill et al. 2007
Bosnia100422.00.0Rootsi et al. 2004
Bulgaria80826.64.30.0Karachanak et al. 2013
Czech Republic4731.98.50.0Underhill et al. 2007
Czech Republic5317.01.90.0Rootsi et al. 2004
Denmark12239.3% (48/122)34.8% (40/122)0.0Underhill et al. 2007
England10419.215.40.0Underhill et al. 2007
Estonia21018.614.80.5Rootsi et al. 2004
Estonia11811.9Lappalainen et al. 2008
Finland (national)28.0Lappalainen et al. 2006
Finland: West23040% (92/230)Lappalainen et al. 2008
Finland: East30619% (58/306)Lappalainen et al. 2008
Finland: Satakunta region50+Lappalainen et al. 20089
France5817.28.61.7Underhill et al. 2007
France1216.716.70.0Cann et al. 2002
France (Low Normandy)4221.411.90.0Rootsi et al. 2004
Germany1252415.20.0Underhill et al. 2007
Greece17115.82.30.0Underhill et al. 2007
Hungary11325.713.30.0Rootsi et al. 2004
Ireland100116.00.0Underhill et al. 2007
Volga Tatars 5313.211.30.0Trofimova 2015
Latvia1133.5Lappalainen et al. 2008
Lithuania1644.9Lappalainen et al. 2008
Netherlands9320.4140.0Underhill et al. 2007
Norway176637% (653/1766)Stenersen et al. 2006
Russia (national)162512.50.0Cann et al. 2002
Russia: Pskov13016.95.40.0Underhill et al. 2007
Russia: Kostroma5326.411.30.0Underhill et al. 2007
Russia: Smolensk10312.61.90.0Underhill et al. 2007
Russia: Voronez9619.83.10.0Underhill et al. 2007
Russia: Arkhangelsk14515.87.60.0Underhill et al. 2007
Russia: Cossacks8924.74.50.0Underhill et al. 2007
Russia: Karelians140108.60.0Underhill et al. 2007
Russia: Karelians13215.2Lappalainen et al. 2008
Russia: Vepsa395.12.60.0Underhill et al. 2007
Slovakia7014.34.30.0Rootsi et al. 2004
Slovenia9526.37.40.0Underhill et al. 2007
Sweden (national)16035.6% (57/160)Lappalainen et al. 2008
Sweden (national)38.0Lappalainen et al. 2009
Sweden: Västra Götaland52Lappalainen et al. 2009
Switzerland1447.65.60.0Rootsi et al. 2004
Turkey5235.41.10.0Underhill et al. 2007
Ukraine: Lviv10123.84.90.0Underhill et al. 2007
Ukraine: Ivanovo-Frankiv5621.41.80.0Underhill et al. 2007
Ukraine: Hmelnitz17626.26.10.0Underhill et al. 2007
Ukraine: Cherkasy 11428.14.30.0Underhill et al. 2007
Ukraine: Bilhorod5626.85.30.0Underhill et al. 2007
Map showing the distribution of Y chromosomes in a trans section of England and Wales from the paper "Y Chromosome Evidence for Anglo-Saxon Mass Migration". The authors attribute the differences in frequencies of haplogroup I1 to Anglo-Saxon mass migration into England, but not into Wales. Weal.png
Map showing the distribution of Y chromosomes in a trans section of England and Wales from the paper "Y Chromosome Evidence for Anglo-Saxon Mass Migration". The authors attribute the differences in frequencies of haplogroup I1 to Anglo-Saxon mass migration into England, but not into Wales.

In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I1 in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period. [59] The authors assumed that populations with large proportions of haplogroup I1 originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was

that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number ... This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea ... These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.

Distribution of Y chromosome haplogroups from Capelli et al. (2003). Haplogroup I-M253 is present in all populations, with higher frequencies in the east and lower frequencies in the west. There appears to be no discrete boundary as observed by Weale et al. (2002) Eng welsh ibd.png
Distribution of Y chromosome haplogroups from Capelli et al. (2003). Haplogroup I-M253 is present in all populations, with higher frequencies in the east and lower frequencies in the west. There appears to be no discrete boundary as observed by Weale et al. (2002)

In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues. [60] This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I1 frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.

Prominent members of I-M253

Through direct testing or testing of their descendants and genealogical evidence, the following notable people have been shown to be I-M253:

Markers

DNA example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism). Dna-SNP.svg
DNA example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism).

The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.

Name: M253 [103]

Type: SNP
Source: M (Peter Underhill of Stanford University)
Position: ChrY:13532101..13532101 (+ strand)
Position (base pair): 283
Total size (base pairs): 400
Length: 1
ISOGG HG: I1
Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG
Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT
YCC HG: I1
Nucleotide alleles change (mutation): C to T

Name: M307 [104]

Type: SNP
Source: M (Peter Underhill)
Position: ChrY:21160339..21160339 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: TTATTGGCATTTCAGGAAGTG
Primer R: GGGTGAGGCAGGAAAATAGC
YCC HG: I1
Nucleotide alleles change (mutation): G to A

Name: P30 [105]

Type: SNP
Source: PS (Michael Hammer of the University of Arizona and James F. Wilson, at the University of Edinburgh)
Position: ChrY:13006761..13006761 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: GGTGGGCTGTTTGAAAAAGA
Primer R: AGCCAAATACCAGTCGTCAC
YCC HG: I1
Nucleotide alleles change (mutation): G to A
Region: ARSDP

Name: P40 [106]

Type: SNP
Source: PS (Michael Hammer and James F. Wilson)
Position: ChrY:12994402..12994402 (+ strand)
Length: 1
ISOGG HG: I1
Primer F: GGAGAAAAGGTGAGAAACC
Primer R: GGACAAGGGGCAGATT
YCC HG: I1
Nucleotide alleles change (mutation): C to T
Region: ARSDP

See also

Related Research Articles

<span class="mw-page-title-main">Haplogroup I-M170</span> Human Y-chromosome DNA haplogroup

Haplogroup I (M170) is a Y-chromosome DNA haplogroup. It is a subgroup of haplogroup IJ, which itself is a derivative of the haplogroup IJK. Subclades I1 and I2 can be found in most present-day European populations, with peaks in some Northern European and Southeastern European countries.

<span class="mw-page-title-main">Haplogroup G-M201</span> Human Y chromosome DNA grouping common in western Eurasia

Haplogroup G (M201) is a human Y-chromosome haplogroup. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK.

<span class="mw-page-title-main">Haplogroup J-M172</span> Human Y-chromosome DNA haplogroup

In human genetics, Haplogroup J-M172 or J2 is a Y-chromosome haplogroup which is a subclade (branch) of haplogroup J-M304. Haplogroup J-M172 is common in modern populations in Western Asia, Central Asia, South Asia, Southern Europe, Northwestern Iran and North Africa. It is thought that J-M172 may have originated in the Caucasus, Anatolia and/or Western Iran.

<span class="mw-page-title-main">Haplogroup F-M89</span> Human Y chromosome DNA grouping indicating common ancestry

Haplogroup F, also known as F-M89 and previously as Haplogroup FT, is a very common Y-chromosome haplogroup. The clade and its subclades constitute over 90% of paternal lineages outside of Africa.

<span class="mw-page-title-main">Haplogroup Q-M242</span> Human Y chromosome DNA grouping common among Native Americans

Haplogroup Q or Q-M242 is a Y-chromosome DNA haplogroup. It has one primary subclade, Haplogroup Q1 (L232/S432), which includes numerous subclades that have been sampled and identified in males among modern populations.

<span class="mw-page-title-main">Human Y-chromosome DNA haplogroup</span> Human DNA groupings

In human genetics, a human Y-chromosome DNA haplogroup is a haplogroup defined by specific mutations in the non-recombining portions of DNA on the male-specific Y chromosome (Y-DNA). Individuals within a haplogroup share similar numbers of short tandem repeats (STRs) and single-nucleotide polymorphisms (SNPs). The Y-chromosome accumulates approximately two mutations per generation, and Y-DNA haplogroups represent significant branches of the Y-chromosome phylogenetic tree, each characterized by hundreds or even thousands of unique mutations.

Haplogroup I-M438, also known as I2, is a human DNA Y-chromosome haplogroup, a subclade of haplogroup I-M170. Haplogroup I-M438 originated some time around 26,000–31,000 BCE. It originated in Europe and developed into several main subgroups: I2-M438*, I2a-L460, I2b-L415 and I2c-L596. The haplogroup can be found all over Europe and reaches its maximum frequency in the Dinaric Alps (Balkans) via founder effect, related to the migrations of the Early Slavs to the Balkan peninsula.

<span class="mw-page-title-main">Genetic studies on Sami</span> Sami people genetics

Genetic studies on Sami is the genetic research that have been carried out on the Sami people. The Sami languages belong to the Uralic languages family of Eurasia.

Haplogroup IJ (M429/P125) is a human Y-chromosome DNA haplogroup, an immediate descendant of Haplogroup IJK. IJK is a branch of Haplogroup HIJK.

<span class="mw-page-title-main">Haplogroup DE</span> Human Y chromosome DNA grouping indicating common ancestry

Haplogroup DE is a human Y-chromosome DNA haplogroup. It is defined by the single nucleotide polymorphism (SNP) mutations, or UEPs, M1(YAP), M145(P205), M203, P144, P153, P165, P167, P183. DE is unique because it is distributed in several geographically distinct clusters. An immediate subclade, haplogroup D, is mainly found in East Asia, parts of Central Asia, and the Andaman Islands, but also sporadically in West Africa and West Asia. The other immediate subclade, haplogroup E, is common in Africa, and to a lesser extent the Middle East and southern Europe.

<span class="mw-page-title-main">Haplogroup R1a</span> Human Y-chromosome DNA haplogroup

Haplogroup R1a, or haplogroup R-M420, is a human Y-chromosome DNA haplogroup which is distributed in a large region in Eurasia, extending from Scandinavia and Central Europe to Central Asia, southern Siberia and South Asia.

<span class="mw-page-title-main">Haplogroup R1b</span> Type of paternal lineage

Haplogroup R1b (R-M343), previously known as Hg1 and Eu18, is a human Y-chromosome haplogroup.

<span class="mw-page-title-main">Haplogroup G-M285</span> Human Y-chromosome DNA haplogroup

In human genetics, Haplogroup G-M285 or G-M342, also known as Haplogroup G1, is a Y-chromosome haplogroup. Haplogroup G1 is a primary subclade of haplogroup G.

Genetic studies on Serbs show close affinity to other neighboring South Slavs.

Haplogroup Q-NWT01 is a subclade of Y-DNA Haplogroup Q-MEH2. Haplogroup Q-NWT01 is defined by the presence of the F746/NWT01 Single Nucleotide Polymorphism (SNP).

Population genetics is a scientific discipline which contributes to the examination of the human evolutionary and historical migrations. Particularly useful information is provided by the research of two uniparental markers within our genome, the Y-chromosome (Y-DNA) and mitochondrial DNA (mtDNA), as well as autosomal DNA. The data from Y-DNA and autosomal DNA suggests that the Croats mostly are descendants of the Slavs of the medieval migration period, according to mtDNA have genetic diversity which fits within a broader European maternal genetic landscape, and overall have a uniformity with other South Slavs from the territory of former Yugoslavia.

<span class="mw-page-title-main">Haplogroup R-M269</span> Gene group

Haplogroup R-M269 is the sub-clade of human Y-chromosome haplogroup R1b that is defined by the SNP marker M269. According to ISOGG 2020 it is phylogenetically classified as R1b1a1b. It underwent intensive research and was previously classified as R1b1a2, R1b1c, R1b1b2 and R1b1a1a2.

<span class="mw-page-title-main">Haplogroup E-M2</span> Human Y-chromosome DNA haplogroup

Haplogroup E-M2, also known as E1b1a1-M2, is a human Y-chromosome DNA haplogroup. E-M2 is primarily distributed within Africa followed by West Asia. More specifically, E-M2 is the predominant subclade in West Africa, Central Africa, Southern Africa, and the region of the African Great Lakes; it also occurs at moderate frequencies in North Africa, and the Middle East. E-M2 has several subclades, but many of these subhaplogroups are included in either E-L485 or E-U175. E-M2 is especially common among indigenous Africans who speak Niger-Congo languages, and was spread to Southern Africa and East Africa through the Bantu expansion.

Haplogroup I-Z63, also known as I1a3 per the International Society of Genetic Genealogy ('ISOGG), is a Y chromosome haplogroup. It is correlated with a DYS456 value inferior to 15, but there are exceptions. It is a subgroup of Haplogroup I-M253.

References

  1. 1 2 3 "I1 YTree". Yfull.com. 2022-04-06. Retrieved 2022-04-19.
  2. 1 2 Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
  3. 1 2 3 Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, et al. (May 2015). "Large-scale recent expansion of European patrilineages shown by population resequencing". Nature Communications. 6: 7152. Bibcode:2015NatCo...6.7152B. doi:10.1038/ncomms8152. PMC   4441248 . PMID   25988751.
  4. ↑ Rootsi S, Magri C, Kivisild T, Benuzzi G, Help H, Bermisheva M, et al. (July 2004). "Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in europe" (PDF). American Journal of Human Genetics. 75 (1): 128–37. doi:10.1086/422196. PMC   1181996 . PMID   15162323. Archived from the original (PDF) on 2009-06-24. Retrieved 2008-03-20.
  5. ↑ Underhill PA, Myres NM, Rootsi S, Chow CT, Lin AA, Otillar RP, et al. (2007). "New phylogenetic relationships for Y-chromosome haplogroup I: reappraising its phylogeography and prehistory.". In Mellars P, Boyle K, Bar-Yosef O, Stringe C (eds.). Rethinking the Human Revolution. Cambridge, UK: McDonald Institute Monographs. pp. 33–42. ISBN   978-1-902937-46-5.
  6. ↑ Lappalainen, T.; Laitinen, V.; Salmela, E.; Andersen, P.; Huoponen, K.; Savontaus, M.-L.; Lahermo, P. (2008). "Migration Waves to the Baltic Sea Region". Annals of Human Genetics. 72 (3): 337–348. doi: 10.1111/j.1469-1809.2007.00429.x . PMID   18294359. S2CID   32079904.
  7. 1 2 ISOGG, Y-DNA Haplogroup I and its Subclades – 2017 (31 January 2017).
  8. 1 2 Lappalainen T, Laitinen V, Salmela E, Andersen P, Huoponen K, Savontaus ML, Lahermo P (May 2008). "Migration waves to the Baltic Sea region". Annals of Human Genetics. 72 (Pt 3): 337–348. doi: 10.1111/j.1469-1809.2007.00429.x . PMID   18294359. S2CID   32079904.
  9. ↑ Lappalainen T, Hannelius U, Salmela E, von Döbeln U, Lindgren CM, Huoponen K, et al. (January 2009). "Population structure in contemporary Sweden—a Y-chromosomal and mitochondrial DNA analysis". Annals of Human Genetics. 73 (1): 61–73. doi:10.1111/j.1469-1809.2008.00487.x. PMID   19040656. S2CID   205598345.
  10. ↑ "FamilyTreeDNA – Sweden DNA PROJECT – Sverigeprojektet".
  11. ↑ Dupuy BM, Stenersen M, Lu TT, Olaisen B (December 2006). "Geographical heterogeneity of Y-chromosomal lineages in Norway". Forensic Science International. 164 (1): 10–19. doi:10.1016/j.forsciint.2005.11.009. PMID   16337760.
  12. ↑ "FamilyTreeDNA – The Norway DNA Project – Norgesprosjektet". familytreedna.com. Retrieved 2020-11-26.
  13. ↑ "Y-DNA Haplogrupper". Norway DNA Norgesprosjektet. Retrieved 2020-12-27.
  14. 1 2 Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33–42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.
  15. ↑ Sanchez JJ (2004). "Y chromosome SNP haplogroups in Danes, Greenlanders and Somalis" (PDF). International Congress Series. 1261: 347–49. doi:10.1016/S0531-5131(03)01635-2 – via isfg.org.
  16. ↑ "FamilyTreeDNA – Denmark DNA Project". familytreedna.com. Retrieved 2020-12-10.
  17. ↑ Helgason A, Sigureth ardóttir S, Nicholson J, Sykes B, Hill EW, Bradley DG, et al. (September 2000). "Estimating Scandinavian and Gaelic ancestry in the male settlers of Iceland". American Journal of Human Genetics. 67 (3): 697–717. doi:10.1086/303046. PMC   1287529 . PMID   10931763.
  18. ↑ "The Greater Nordic Regional Y-DNA Project". familytreedna. April 2021.
  19. ↑ Ebenesersdóttir SS, Sandoval-Velasco M, Gunnarsdóttir ED, Jagadeesan A, Guðmundsdóttir VB, Thordardóttir EL, et al. (June 2018). "Ancient genomes from Iceland reveal the making of a human population". Science. 360 (6392): 1028–1032. Bibcode:2018Sci...360.1028E. doi: 10.1126/science.aar2625 . hdl: 10852/71890 . PMID   29853688.
  20. ↑ Lappalainen T, Koivumäki S, Salmela E, Huoponen K, Sistonen P, Savontaus ML, Lahermo P (July 2006). "Regional differences among the Finns: a Y-chromosomal perspective". Gene. 376 (2): 207–15. doi:10.1016/j.gene.2006.03.004. PMID   16644145.
  21. ↑ "Blood of the Isles: exploring the genetic roots of our tribal history". History Ireland. 2013-02-22. Retrieved 2020-12-10.
  22. ↑ Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (May 2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–38. doi:10.1101/gr.7172008. PMC   2336805 . PMID   18385274.
  23. ↑ Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, et al. (May 2015). "Large-scale recent expansion of European patrilineages shown by population resequencing". Nature Communications. 6 (1): 7152. Bibcode:2015NatCo...6.7152B. doi:10.1038/ncomms8152. PMC   4441248 . PMID   25988751.
  24. 1 2 "Welcome to FamilyTreeDNA Discover (Beta)". FamilyTreeDNA Discover (Beta). Retrieved 2022-12-25.
  25. ↑ "I-DF29 YTree". yfull.com. Retrieved 2022-12-25.
  26. ↑ Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, et al. (October 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Proceedings. Biological Sciences. 286 (1912): 20191528. doi:10.1098/rspb.2019.1528. PMC   6790770 . PMID   31594508.
  27. ↑ "I-Y11204 YTree". yfull.com. Retrieved 2022-12-25.
  28. ↑ Allentoft, Morten E.; Sikora, Martin; Fischer, Anders; Sjögren, Karl-Göran; Ingason, Andrés; Macleod, Ruairidh; Rosengren, Anders; Schulz Paulsson, Bettina; Jørkov, Marie Louise Schjellerup; Novosolov, Maria; Stenderup, Jesper; Price, T. Douglas; Fischer Mortensen, Morten; Nielsen, Anne Birgitte; Ulfeldt Hede, Mikkel (January 2024). "100 ancient genomes show repeated population turnovers in Neolithic Denmark". Nature. 625 (7994): 329–337. doi:10.1038/s41586-023-06862-3. ISSN   1476-4687. PMC   10781617 . PMID   38200294.
  29. ↑ "Haplotree.info – ancientdna.info. Map based on All Ancient DNA v. 2.07.26".
  30. ↑ Gunther T (2017). "Genomics of Mesolithic Scandinavia reveal colonization routes and high-latitude adaptation" (PDF). Nature. 23: 6 – via Biorxiv.
  31. ↑ SF11 – Stora Förvar, Stora Karlsö I-Z2699*. "Haplotree.info sample: SF11". haplotree.info.{{cite web}}: CS1 maint: numeric names: authors list (link)
  32. 1 2 Skoglund P, Malmström H, Omrak A, Raghavan M, Valdiosera C, Günther T, et al. (May 2014). "Genomic diversity and admixture differs for Stone-Age Scandinavian foragers and farmers". Science. 344 (6185): 747–50. Bibcode:2014Sci...344..747S. doi: 10.1126/science.1253448 . PMID   24762536. S2CID   206556994.
  33. ↑ "familytreedna.com I-Z2699 tree". familytreedna. April 2021.
  34. ↑ Szécsényi-Nagy A, Brandt G, Haak W, Keerl V, Jakucs J, Möller-Rieker S, et al. (April 2015). "Tracing the genetic origin of Europe's first farmers reveals insights into their social organization". Proceedings. Biological Sciences. 282 (1805). doi:10.1098/rspb.2015.0339. PMC   4389623 . PMID   25808890.
  35. ↑ "BAB5 I-Z2699*". haplotree.info.
  36. ↑ Vyas, Deven N.; Koncz, István; Modi, Alessandra; Mende, Balázs Gusztáv; Tian, Yijie; Francalacci, Paolo; Lari, Martina; Vai, Stefania; Straub, Péter; Gallina, Zsolt; Szeniczey, Tamás; Hajdu, Tamás; Pejrani Baricco, Luisella; Giostra, Caterina; Radzevičiūtė, Rita (2023-09-25). "Fine-scale sampling uncovers the complexity of migrations in 5th-6th century Pannonia". Current Biology. 33 (18): 3951–3961.e11. doi:10.1016/j.cub.2023.07.063. hdl: 11584/373523 . ISSN   1879-0445. PMID   37633281.
  37. 1 2 3 Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. PMID   26062507. S2CID   4399103.
  38. ↑ "YFull | The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". yfull.com. Retrieved 2021-01-24.
  39. ↑ Malmstrom H (July 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon" (PDF). Uppsala Genomics. 1: 3 – via jakobssonlab.iob.uu.se/.
  40. ↑ "I-Y11204 YTree".
  41. ↑ Sánchez-Quinto F, Malmström H, Fraser M, Girdland-Flink L, Svensson EM, Simões LG, et al. (May 2019). "Megalithic tombs in western and northern Neolithic Europe were linked to a kindred society". Proceedings of the National Academy of Sciences of the United States of America. 116 (19): 9469–74. Bibcode:2019PNAS..116.9469S. doi: 10.1073/pnas.1818037116 . PMC   6511028 . PMID   30988179.
  42. ↑ Malmström H, Linderholm A, Skoglund P, Storå J, Sjödin P, Gilbert MT, et al. (January 2015). "Ancient mitochondrial DNA from the northern fringe of the Neolithic farming expansion in Europe sheds light on the dispersion process". Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences. 370 (1660): 20130373. doi:10.1098/rstb.2013.0373. PMC   4275881 . PMID   25487325.
  43. ↑ Karlsson AO, Wallerström T, Götherström A, Holmlund G (August 2006). "Y-chromosome diversity in Sweden – a long-time perspective". European Journal of Human Genetics. 14 (8): 963–70. doi: 10.1038/sj.ejhg.5201651 . PMID   16724001. S2CID   23227271.
  44. ↑ Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, et al. (October 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Proceedings. Biological Sciences. 286 (1912): 20191528. doi:10.1098/rspb.2019.1528. PMC   6790770 . PMID   31594508.
  45. ↑ Poznik GD, Xue Y, Mendez FL, Willems TF, Massaia A, Wilson Sayres MA, et al. (June 2016). "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences". Nature Genetics. 48 (6): 593–99. doi:10.1038/ng.3559. hdl: 11858/00-001M-0000-002A-F024-C . PMC   4884158 . PMID   27111036.
  46. ↑ Woodley M (February 2017). "Holocene selection for variants associated with cognitive ability: Comparing ancient and modern genomes" (PDF). biorxiv.org/. doi: 10.1101/109678 . S2CID   196631764 . Retrieved 27 January 2021.
  47. ↑ Schmidt KH (1991). "The Celts and the Ethnogenesis of the Germanic People". Historische Sprachforschung / Historical Linguistics. 104 (1): 129–52. ISSN   0935-3518. JSTOR   40849016.
  48. ↑ Bergerbrant S (May 2007). "Bronze Age Identities: Costume, Conflict and Contact in Northern Europe 1600–1300 BC" (PDF). Stockholm Studies in Archaeology. 43: 7–201 – via diva-portal.org.
  49. ↑ Teska M, Michalowski A (2014). "Connection between Wielkopolska and the Baltic Sea Region in the Roman Iron". Archaeologia Lituana. 14: 63–77. doi: 10.15388/ArchLit.2013.0.2641 . S2CID   56295624.
  50. ↑ Zenczak M, Handschuh L, Juras A, Marcinkowska-Swojak M, Philips A, Piontek J, Stolarek I, Figlerowicz M (2017). Y-Chromosome Haplogroup Assignment Through Next Generation Sequencing of Enriched Ancient DNA Libraries. Anthropological Genetics. p. Presentation number: AG 16.
  51. ↑ Amorim CE, Vai S, Posth C, Modi A, Koncz I, Hakenbeck S, et al. (September 2018). "Understanding 6th-century barbarian social organization and migration through paleogenomics". Nature Communications. 9 (1): 3547. Bibcode:2018NatCo...9.3547A. doi:10.1038/s41467-018-06024-4. PMC   6134036 . PMID   30206220.
  52. ↑ Estes R (2020-10-16). "Longobards Ancient DNA from Pannonia and Italy – What Does Their DNA Tell Us? Are You Related?". DNAeXplained – Genetic Genealogy. Retrieved 2020-12-11.
  53. ↑ Labudde D (July 2015). "Gender distribution of excavation finds from the Roman imperial and migration period". ResearchGate. 1: 2 – via ResearchGate.net.
  54. ↑ Antonio ML, Gao Z, Moots HM, Lucci M, Candilio F, Sawyer S, et al. (November 2019). "Ancient Rome: A genetic crossroads of Europe and the Mediterranean". Science. 366 (6466): 708–14. Bibcode:2019Sci...366..708A. doi:10.1126/science.aay6826. PMC   7093155 . PMID   31699931.
  55. ↑ Olalde I, Mallick S, Patterson N, Rohland N, Villalba-Mouco V, Silva M, et al. (March 2019). "The genomic history of the Iberian Peninsula over the past 8000 years". Science. 363 (6432): 1230–34. Bibcode:2019Sci...363.1230O. doi:10.1126/science.aav4040. PMC   6436108 . PMID   30872528.
  56. ↑ Martiniano R, Caffell A, Holst M, Hunter-Mann K, Montgomery J, Müldner G, et al. (January 2016). "Genomic signals of migration and continuity in Britain before the Anglo-Saxons". Nature Communications. 7 (1): 10326. Bibcode:2016NatCo...710326M. doi:10.1038/ncomms10326. PMC   4735653 . PMID   26783717.
  57. ↑ Gretzinger, Joscha; Sayer, Duncan; Justeau, Pierre; Altena, Eveline; Pala, Maria; Dulias, Katharina; Edwards, Ceiridwen J.; Jodoin, Susanne; Lacher, Laura; Sabin, Susanna; Vågene, Åshild J.; Haak, Wolfgang; Ebenesersdóttir, S. Sunna; Moore, Kristjan H. S.; Radzeviciute, Rita (October 2022). "The Anglo-Saxon migration and the formation of the early English gene pool". Nature. 610 (7930): 112–119. doi:10.1038/s41586-022-05247-2. ISSN   1476-4687. PMC   9534755 . PMID   36131019.
  58. ↑ Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, et al. (September 2020). "Population genomics of the Viking world". Nature. 585 (7825): 390–96. Bibcode:2020Natur.585..390M. bioRxiv   10.1101/703405 . doi:10.1038/s41586-020-2688-8. hdl: 10852/83989 . PMID   32939067. S2CID   201195157.
  59. ↑ Weale ME, Weiss DA, Jager RF, Bradman N, Thomas MG (July 2002). "Y chromosome evidence for Anglo-Saxon mass migration". Molecular Biology and Evolution. 19 (7): 1008–21. doi: 10.1093/oxfordjournals.molbev.a004160 . PMID   12082121.
  60. ↑ Capelli C, Redhead N, Abernethy JK, Gratrix F, Wilson JF, Moen T, et al. (May 2003). "A Y chromosome census of the British Isles". Current Biology. 13 (11): 979–84. doi:10.1016/S0960-9822(03)00373-7. hdl: 20.500.11820/8acb01f3-a7c1-45f5-89de-b796266d651e . PMID   12781138. S2CID   526263.
  61. ↑ "Founding Father DNA". isogg.org.
  62. ↑ "FamilyTreeDNA – Genetic Testing for Ancestry, Family History & Genealogy". familytreedna.com. Retrieved 2020-12-10.
  63. ↑ "Faderslinjen, DNA". sikaby.se. Retrieved 2020-12-10.
  64. ↑ "FamilyTreeDNA – RussiaDNA Project". familytreedna.com. Retrieved 2020-12-10.
  65. ↑ "Vår vikingahövding i österled". sikaby.se. Retrieved 2020-12-10.
  66. ↑ "Sample from Homo sapiens – BioSample – NCBI". ncbi.nlm.nih.gov. Retrieved 2020-12-10.
  67. ↑ Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, et al. (September 2020). "Population genomics of the Viking world". Nature. 585 (7825): 390–96. Bibcode:2020Natur.585..390M. doi:10.1038/s41586-020-2688-8. hdl: 10852/83989 . PMID   32939067. S2CID   221769227.
  68. ↑ Duczko W (2004). Viking Rus: Studies on the Presence of Scandinavians in Eastern Europe. Brill. ISBN   978-90-04-13874-2.
  69. ↑ Malmström H, Vretemark M, Tillmar A, Durling MB, Skoglund P, Gilbert MT, et al. (January 2012). "Finding the founder of Stockholm – a kinship study based on Y-chromosomal, autosomal and mitochondrial DNA". Annals of Anatomy - Anatomischer Anzeiger. Special Issue: Ancient DNA. 194 (1): 138–45. doi:10.1016/j.aanat.2011.03.014. PMID   21596538.
  70. ↑ The British Invasion Finding Your Roots
  71. 1 2 "Mayflower DNA Project". mayflowerdna.org. Retrieved 2020-11-23.
  72. ↑ "FamilyTreeDNA – Lee Surname DNA Research Project (and Leigh, Lea, etc)". familytreedna.com. Retrieved 2020-12-10.
  73. ↑ "FamilyTreeDNA – Grimaldi Genealogy Project at FtDNA". familytreedna.com. Retrieved 2020-12-11.
  74. ↑ "Jackson DNA Project". FamilyTreeDNA. 11 December 2020.
  75. ↑ Hay M (July 2020). "Origins and history of Haplogroup I1 (Y-DNA)". ResearchGate. 1: 9.
  76. 1 2 3 Maciamo E. "Haplogroup I1 (Y-DNA)". Eupedia. Retrieved 2020-12-11.
  77. ↑ Петр Толстой. Моя родословная. Выпуск от 18.04.2010 (in Russian), retrieved 2020-12-15
  78. ↑ "I-BY229 YTree". yfull.com. Retrieved 2020-12-10.
  79. ↑ "Swedenborg". Höijen (in Swedish). Archived from the original on 2020-10-26. Retrieved 2020-12-10.
  80. ↑ "Claas Jansz van Rensburg, SV/PROG". geni_family_tree. Retrieved 2021-01-03.
  81. ↑ "janse /jansen van Rensburg I-M253 genealogy discussion". geni_family_tree. Retrieved 2021-01-03.
  82. ↑ "Rolf H. Nevanlinna". geni_family_tree. Retrieved 2020-12-26.
  83. ↑ olenus (2018-03-30). "I1: Rolf Nevanlinna (né Neovius)". Descendants of haplogroup IJ-M429. Retrieved 2020-12-26.
  84. ↑ "Arne Edvard Nevanlinna". geni_family_tree. Retrieved 2020-12-26.
  85. ↑ "Morse/Moss DNA Testing". morsesociety.org. Retrieved 2020-12-10.
  86. ↑ "FamilyTreeDNA – Morse / Moss DNA Project". familytreedna.com. Retrieved 2020-12-10.
  87. ↑ "Peter Morse's Family Tree". geni.com. Retrieved 2020-12-10.
  88. ↑ "FamilyTreeDNA – Sweden DNA Project – Sverigeprojektet". familytreedna.com. Retrieved 2021-02-14.
  89. ↑ "Eskilstuna kommun · EM GN398 – Familjen Larsson, Torshälla ca 1900". Eskilstuna kommun (in Swedish). Retrieved 2021-02-14.
  90. ↑ "I-Y24470 YTree". yfull.com. Retrieved 2021-02-14.
  91. ↑ "Familjen Larssons Anfäder". hosserudkullen.se. Retrieved 2021-02-14.
  92. ↑ Archived at Ghostarchive and the Wayback Machine : "I Did A DNA Test... (I Guess Im Cancelled Now)". 25 January 2021 – via YouTube.
  93. ↑ "FamilyTreeDNA – The Norway DNA Project – Norgesprosjektet". familytreedna.com. Retrieved 2021-02-02.
  94. ↑ Tovseth A (June 2018). "Andrésen, Färnskog & Hansen family research". Kjellivar.tripod.com. Retrieved 2 February 2021.
  95. ↑ "Personer med namnet Andresen | Släktingar.se". slaktingar.se. Retrieved 2021-02-02.
  96. ↑ "Björn Andresen: Min passion för mamma blev aldrig besvarad – Katarina Hahr möter". Radio Sveriges (in Swedish). 2 October 2020. Retrieved 2021-02-02.
  97. ↑ "Johan Peter Andresen – Ancestry". ancestry.se. Retrieved 2021-02-02.
  98. ↑ "Family tree of Daniel Andresen". Geneanet. Retrieved 2021-02-02.
  99. ↑ "FamilyTreeDNA – Pine/Pyne Genealogy DNA Project". familytreedna.com. Retrieved 2020-12-10.
  100. ↑ "James Pine, Sr". geni_family_tree. Retrieved 2020-12-10.
  101. ↑ Janlind F (20 February 2021). "Bianca Salming om relationen med Börje: "Känner mig hemsk"" [Bianca Salming on her relationship with Börje: "Feeling awful"]. Goteborgs-Posten (in Swedish).
  102. ↑ Mercedes (2023-03-26). "Beethoven DNA Discovery – Find Out If You Are Related". Who are You Made Of?. Retrieved 2023-10-07.
  103. ↑ snpdev. "Reference SNP (refSNP) Cluster Report: rs9341296". nih.gov.
  104. ↑ snpdev. "Reference SNP (refSNP) Cluster Report: rs13447354". nih.gov.
  105. ↑ P30 [ permanent dead link ]
  106. ↑ P40 [ permanent dead link ]

Further reading

Haplogroup I databases
General Y-DNA databases

There are several public access databases featuring I-M253, including:

  1. Archived 2011-01-04 at the Wayback Machine
  2. YHRD : Y-Chromosome STR Haplotype Reference Database
  3. I1 YTree
This page is based on this Wikipedia article
Text is available under the CC BY-SA 4.0 license; additional terms may apply.
Images, videos and audio are available under their respective licenses.