| Icerudivirus | |
|---|---|
 | |
| Rudiviridae virion | |
Virus classification  | |
| (unranked): | Virus |
| Realm: | Adnaviria |
| Kingdom: | Zilligvirae |
| Phylum: | Taleaviricota |
| Class: | Tokiviricetes |
| Order: | Ligamenvirales |
| Family: | Rudiviridae |
| Genus: | Icerudivirus |
Icerudivirus is a genus of viruses in the family Rudiviridae . These viruses are non-enveloped, stiff-rod-shaped viruses with linear dsDNA genomes, that infect hyperthermophilic archaea of the species Sulfolobus islandicus . [1] [2] There are three species in the genus. [3]
The following species are assigned to the genus: [3]
Icerudivirus was previously named Rudivirus but was renamed in 2020. [7]
SIRV1 and SIRV2 were produced by colony-cloned Sulfolobus islandicus strains. The two strains were isolated from samples taken in 1994 from different solfataric fields in Iceland, the Kverkfjöll and Hveragerði, which are separated by a distance of 250 km. These Icelandic solfataric acidic hot springs reach a temperature of 88 °C and pH 2.5. [8]
Virions are non-enveloped, consisting of a tube-like superhelix formed by dsDNA and the major structural protein, with plugs at each end to which three tail fibers are anchored. These tail fibers appear to be involved in adsorption onto the host cell surface and are formed by one of the minor structural proteins.[ citation needed ]
SIRV1 and SIRV2 are stiff rods of about 23 nm in width, but differing in length—SIRV1 is about 830 nm and SIRV2 is about 900 nm long. They present a central channel of approx. 6 nm that encapsidates the DNA genome. At each terminus of the rod there is a plug of approx. 48 nm in length and 6 nm in diameter that fills the terminal portion of the cavity, together with three tail fibres of approx. 28 nm in length.[ citation needed ]
A three-dimensional reconstruction of the SIRV2 virion at ~4 angstrom resolution has been obtained by cryo–electron microscopy. [9] The structure revealed a previously unknown form of virion organization, in which the alpha-helical major capsid protein of SIRV2 wraps around the DNA, making it inaccessible to solvent. The viral DNA was found to be entirely in the A-form, which suggests a common mechanism with bacterial spores for protecting DNA in the most adverse environments.
The genome is composed of linear dsDNA and ranges from 24 kb (ARV1) to 35 kb (SIRV2). The two strands of the linear genomes are covalently linked and, at both ends of the genome, there are inverted terminal repeats. The Sulfolobus rudiviruses size up to 32.3 kbp for SIRV1 and 35.8 kbp for SIRV2, with inverted terminal repeats of 2029 bp at the ends of the linear genome. The G+C content of both genomes is extremely low, of only 25%, whereas the genome of Sulfolobus solfataricus (the sequenced genome closest to the virus host) hits 37%.
Although the sequences of the inverted terminal repeats of the rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends, which may constitute a signal for the Holliday junction resolvase [10] and DNA replication.
The transcriptional patterns of SIRV1 and SIRV2 are relatively simple, with few temporal expression differences. [11] In contrast, at least 10% of its genes were predicted to have of different DNA binding motifs in the proteins they code and were assigned to be putative transcriptional regulators. [12] A high proportion of viral genes coding for DNA binding proteins with the ribbon-helix-helix (RHH) DNA binding motifs has been suggested. The abundance of genes coding for proteins belonging to the RHH superfamily present in the genomes of crenarchaea and their viruses could underline the important role of these proteins in host and viral gene transcription regulation under harsh conditions.
Protein SvtR [13] was the first crenarchaeal RHH regulator characterized in details and also the first viral coded transcriptional regulators within the Archaeal domain. It strongly represses the transcription of the minor structural protein and, to a lesser extent, of its own gene. The structure is very similar to that of bacterial RHH proteins despite the low sequence similarity, such as CopG, a bacterial plasmid copy number control regulator.
A Sulfolobus islandicus coded transcription activator, Sta1, has also been shown to activate transcription of several viral genes. [14]
SIRV2 recognizes its host by binding to type 4 pili abundantly present on the cell surface. [15] [16] The virus initially binds to the tip of the pilus and subsequently advances along the pilus to the cell surface, where the virion disassembles and the SIRV2 genome is internalized by an unknown mechanism. [15] SIRV2 is a lytic virus that kills the host cell as a consequence of elaborated mechanisms orchestrated by the virus. Massive degradation of the host chromosomes occurs because of virus infection and virion assembly occurs in the cytoplasm. Virions are released from the host cell through a mechanism that involves the formation of specific cellular structures. [17]
SIRV2 can act as a template for site-selective and spatially controlled chemical modification. Both the ends and the body of the virus, or the ends only, can be chemically addressed, thus SIRV2 can be regarded as a structurally unique nanobuilding block. [18]
Lipothrixviridae is a family of viruses in the order Ligamenvirales. Thermophilic archaea in the phylum Thermoproteota serve as natural hosts. There are 11 species in this family, assigned to 4 genera.
Fuselloviridae is a family of viruses. Sulfolobus species, specifically shibatae, solfataricus, and islandicus, serve as natural hosts. There are two genera and nine species in the family. The Fuselloviridae are ubiquitous in high-temperature (≥70 °C), acidic hot springs around the world.
Guttaviridae is a family of viruses. Archaea serve as natural hosts. There are two genera in this family, containing one species each. The name is derived from the Latin gutta, meaning 'droplet'.
Globuloviridae is a family of hyperthermophilic archaeal viruses. Crenarchaea of the genera Pyrobaculum and Thermoproteus serve as natural hosts. There are four species in this family, assigned to a single genus, Alphaglobulovirus.
Bottigliavirus is the only genus in the family Ampullaviridae and contains 3 species. Ampullaviridae infect archaea of the genus Acidianus. The name of the family and genus is derived from the Latin word for bottle, ampulla, due to the virions having the shape of a bottle. The family was first described during an investigation of the microbial flora of hot springs in Italy.
Bicaudaviridae is a family of hyperthermophilic archaeal viruses. Members of the genus Acidianus serve as natural hosts. There is only one genus, Bicaudavirus, and one species, Acidianus two-tailed virus, in this family. However, Sulfolobus tengchongensis spindle-shaped viruses 1 and 2 are regarded to belong to this family also.
Clavaviridae is a family of double-stranded viruses that infect archaea. This family was first described by the team led by D. Prangishvili in 2010. There is one genus in this family (Clavavirus). Within this genus, a single species has been described to date: Aeropyrum pernix bacilliform virus 1 (APBV1).
Ligamenvirales is an order of linear viruses that infect archaea of the phylum Thermoproteota and have double-stranded DNA genomes. The order was proposed by David Prangishvili and Mart Krupovic in 2012 and subsequently created by the International Committee on Taxonomy of Viruses (ICTV).
David Prangishvili is a virologist, Professor at the Pasteur Institute of Paris, and foremost authority on viruses infecting Archaea.
Alphafusellovirus is a genus of viruses, in the family Fuselloviridae. Species in the genus Sulfolobus serve as natural hosts. There are seven species in this genus.
Tristromaviridae is a family of viruses. Archaea of the genera Thermoproteus and Pyrobaculum serve as natural hosts. Tristromaviridae is the sole family in the order Primavirales. There are two genera and three species in the family.
Betalipothrixvirus is a genus of viruses in the family Lipothrixviridae. Archaea serve as natural hosts. The genus contains six species.
Spiraviridae is a family of incertae sedis viruses that replicate in hyperthermophilic archaea of the genus Aeropyrum, specifically Aeropyrum pernix.The family contains one genus, Alphaspiravirus, which contains one species, Aeropyrum coil-shaped virus. The virions of ACV are non-enveloped and in the shape of hollow cylinders that are formed by a coiling fiber that consists of two intertwining halves of the circular DNA strand inside a capsid. An appendage protrudes from each end of the cylindrical virion. The viral genome is ssDNA(+) and encodes for significantly more genes than other known ssDNA viruses. ACV is also unique in that it appears to lack its own enzymes to aid replication, instead likely using the host cell's replisomes. ACV has no known relation to any other archaea-infecting viruses, but it does share its coil-like morphology with some other archaeal viruses, suggesting that such viruses may be an ancient lineage that only infect archaea.
Sulfolobus islandicus rod-shaped virus 2, also referred to as SIRV2, is an archaeal virus whose only known host is the archaeon Sulfolobus islandicus. This virus belongs to the family Rudiviridae. Like other viruses in the family, it is common in geothermal environments.
Sulfolobus islandicus filamentous virus (SIFV) is an archaeal virus, classified in the family Lipothrixviridae within the order Ligamenvirales. The virus infects hypethermophilic and acidophilic archaeon Sulfolobus islandicus.
In virology, realm is the highest taxonomic rank established for viruses by the International Committee on Taxonomy of Viruses (ICTV), which oversees virus taxonomy. Six virus realms are recognized and united by specific highly conserved traits:
An archaeal virus is a virus that infects and replicates in archaea, a domain of unicellular, prokaryotic organisms. Archaeal viruses, like their hosts, are found worldwide, including in extreme environments inhospitable to most life such as acidic hot springs, highly saline bodies of water, and at the bottom of the ocean. They have been also found in the human body. The first known archaeal virus was described in 1974 and since then, a large diversity of archaeal viruses have been discovered, many possessing unique characteristics not found in other viruses. Little is known about their biological processes, such as how they replicate, but they are believed to have many independent origins, some of which likely predate the last archaeal common ancestor (LACA).
Portogloboviridae is a family of dsDNA viruses that infect archaea. It is a proposed family of the realm Varidnaviria, but ICTV officially puts it as incertae sedis virus. Viruses in the family are related to Helvetiavirae. The capsid proteins of these viruses and their characteristics are of evolutionary importance for the origin of the other Varidnaviria viruses since they seem to retain primordial characters.
Thaspiviridae is a family of incertae sedis spindle-shaped viruses. The family contains a single genus, Nitmarvirus, which contains a single species, Nitmarvirus NSV1.
Adnaviria is a realm of viruses that includes archaeal viruses that have a filamentous virion and a linear, double-stranded DNA genome. The genome exists in A-form (A-DNA) and encodes a dimeric major capsid protein (MCP) that contains the SIRV2 fold, a type of alpha-helix bundle containing four helices. The virion consists of the genome encased in capsid proteins to form a helical nucleoprotein complex. For some viruses, this helix is surrounded by a lipid membrane called an envelope. Some contain an additional protein layer between the nucleoprotein helix and the envelope. Complete virions are long and thin and may be flexible or a stiff like a rod.
{{cite journal}}: CS1 maint: multiple names: authors list (link)
Media related to Icerudivirus at Wikimedia Commons| Components |  | |
|---|---|---|
| Viral life cycle | ||
| Genetics | ||
| By host | ||
| Other | ||
